Biochemistry
9th Edition
ISBN: 9781305961135
Author: Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 13, Problem 39RE
Interpretation Introduction
Interpretation:
The functional difference between PCR and qPCR is to be discussed.
Concept introduction:
Polymerase chain reaction or PCR is the process that is used to make multiple copies of DNA.
PCR is a temperature-based reaction.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Recall what you know about the rules of gel electrophoresis and the migration of DNA on an electrophoresis gel. The PV92 PCR products could be 941bp or 641bp long. We are calling the longer allele that has the Alu insert the "+" allele and the shorter allele that doesn't have the insert the "-" allele. Which fragment will run faster on the electrophoresis gel, the 941bp or the 641bp allele?
941
641
(recall) During DNA replication one nucleotide strand is used as a template for polymerization of another. What WOULD BE THE NUCLEOTIDE (?) in the newly synthesized complementary DNA chain across
from the nucleotide C
template ATGCAGCTCCAGTCGGTAATG
new strand
O none of answers correct
O Tor A
O A
MRI
What is a T1-weighted sequence?
Chapter 13 Solutions
Biochemistry
Ch. 13 - RECALL What advantages does fluorescent labeling...Ch. 13 - RECALL What methods are used to visualize...Ch. 13 - REFLECT AND APPLY When proteins are separated...Ch. 13 - RECALL How does the use of restriction...Ch. 13 - RECALL What is the importance of methylation in...Ch. 13 - RECALL Why do restriction endonucleases not...Ch. 13 - Prob. 7RECh. 13 - Prob. 8RECh. 13 - RECALL What do the following have in common? MOM;...Ch. 13 - RECALL Give three examples of DNA palindromes.
Ch. 13 - RECALL What are three differences between the...Ch. 13 - RECALL What are sticky ends? What is their...Ch. 13 - RECALL What would be an advantage of using HaeIII...Ch. 13 - RECALL Describe the cloning of DNA.Ch. 13 - RECALL What vectors can be used for cloning?Ch. 13 - RECALL Describe the method you would use to test...Ch. 13 - RECALL What is blue/white screening? What is the...Ch. 13 - Prob. 18RECh. 13 - Prob. 19RECh. 13 - Prob. 20RECh. 13 - Prob. 21RECh. 13 - Prob. 22RECh. 13 - Prob. 23RECh. 13 - REFLECT AND APPLY What are the requirements for an...Ch. 13 - Prob. 25RECh. 13 - Prob. 26RECh. 13 - REFLECT AND APPLY The genes for both the a- and...Ch. 13 - REFLECT AND APPLY Outline the methods you would...Ch. 13 - Prob. 29RECh. 13 - Prob. 30RECh. 13 - Prob. 31RECh. 13 - Prob. 32RECh. 13 - RECALL Why is temperature control so important in...Ch. 13 - RECALL Why is the use of temperature-stable DNA...Ch. 13 - RECALL What are the criteria for good primers in a...Ch. 13 - REFLECT AND APPLY What difficulties arise in the...Ch. 13 - REFLECT AND APPLY Each of the following pairs of...Ch. 13 - RECALL What is qPCR?Ch. 13 - Prob. 39RECh. 13 - REFLECT AND APPLY Suppose that you are a...Ch. 13 - REFLECT AND APPLY Why is DNA evidence more useful...Ch. 13 - REFLECT AND APPLY Give the DNA sequence for the...Ch. 13 - Prob. 43RECh. 13 - Prob. 44RECh. 13 - Prob. 45RECh. 13 - Prob. 46RECh. 13 - Prob. 47RECh. 13 - RECALL Has proteomic analysis been done on...Ch. 13 - Prob. 49RECh. 13 - Prob. 50RECh. 13 - Prob. 51RECh. 13 - RECALL What are the key differences between DNA...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- RECALL What would be an advantage of using HaeIII for a cloning experiment? What would be a disadvantage?arrow_forwardRECALL What is blue/white screening? What is the key feature of a plasmid that is used for it?arrow_forwardRECALL Compare and contrast the properties of the enzymes DNA polymerase I and polymerase III from E. coli.arrow_forward
- REFLECT AND APPLY In the MeselsonStahl experiment that established the semiconservative nature of DNA replication, the extraction method produced short fragments of DNA. What sort of results might have been obtained with longer pieces of DNA?arrow_forwardRECALL What is the importance of methylation in the activity of restriction endonucleases?arrow_forwardRECALL What are sticky ends? What is their importance in recombinant DNA technology?arrow_forward
- RECALL What are the key differences between DNA microarrays and protein microarrays, and how they are used in research?arrow_forwardREFLECT AND APPLY Why is a short RNA primer needed for replication?arrow_forwardRECALL Why is the use of temperature-stable DNA polymerase an important factor in the polymerase chain reaction?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biomolecules - Protein - Amino acids; Author: Tutorials Point (India) Ltd.;https://www.youtube.com/watch?v=ySNVPDHJ0ek;License: Standard YouTube License, CC-BY