9th Edition

ISBN: 9781305961135

Author: Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Publisher: Cengage Learning

Concept explainers

We generally tend to think of proteins only from a dietary lens, as a component of what we eat. However, they are among the most important and abundant organic macromolecules in the human body, with diverse structures and functions. Every cell contains t…

Protein Expression

The method by which living organisms synthesize proteins and further modify and regulate them is called protein expression. Protein expression plays a significant role in several types of research and is highly utilized in molecular biology, biochemistry…

Videos

Textbook Question

Chapter 13, Problem 6RE

RECALL Why do restriction endonucleases not hydrolyze DNA from the organism that produces it?

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Chapter 13, Problem 5RE

Chapter 13, Problem 7RE

Students have asked these similar questions

(recall) During DNA replication one nucleotide strand is used as a template for polymerization of another. What WOULD BE THE NUCLEOTIDE (?) in the newly synthesized complementary DNA chain across from the nucleotide C template ATGCAGCTCCAGTCGGTAATG new strand O none of answers correct O Tor A O A

Chapter 13 Solutions

Biochemistry

Ch. 13 - RECALL What advantages does fluorescent labeling...Ch. 13 - RECALL What methods are used to visualize...Ch. 13 - REFLECT AND APPLY When proteins are separated...Ch. 13 - RECALL How does the use of restriction...Ch. 13 - RECALL What is the importance of methylation in...Ch. 13 - RECALL Why do restriction endonucleases not...Ch. 13 - Prob. 7RE Ch. 13 - Prob. 8RE Ch. 13 - RECALL What do the following have in common? MOM;...Ch. 13 - RECALL Give three examples of DNA palindromes.

Ch. 13 - RECALL What are three differences between the...Ch. 13 - RECALL What are sticky ends? What is their...Ch. 13 - RECALL What would be an advantage of using HaeIII...Ch. 13 - RECALL Describe the cloning of DNA.Ch. 13 - RECALL What vectors can be used for cloning?Ch. 13 - RECALL Describe the method you would use to test...Ch. 13 - RECALL What is blue/white screening? What is the...Ch. 13 - Prob. 18RE Ch. 13 - Prob. 19RE Ch. 13 - Prob. 20RE Ch. 13 - Prob. 21RE Ch. 13 - Prob. 22RE Ch. 13 - Prob. 23RE Ch. 13 - REFLECT AND APPLY What are the requirements for an...Ch. 13 - Prob. 25RE Ch. 13 - Prob. 26RE Ch. 13 - REFLECT AND APPLY The genes for both the a- and...Ch. 13 - REFLECT AND APPLY Outline the methods you would...Ch. 13 - Prob. 29RE Ch. 13 - Prob. 30RE Ch. 13 - Prob. 31RE Ch. 13 - Prob. 32RE Ch. 13 - RECALL Why is temperature control so important in...Ch. 13 - RECALL Why is the use of temperature-stable DNA...Ch. 13 - RECALL What are the criteria for good primers in a...Ch. 13 - REFLECT AND APPLY What difficulties arise in the...Ch. 13 - REFLECT AND APPLY Each of the following pairs of...Ch. 13 - RECALL What is qPCR?Ch. 13 - Prob. 39RE Ch. 13 - REFLECT AND APPLY Suppose that you are a...Ch. 13 - REFLECT AND APPLY Why is DNA evidence more useful...Ch. 13 - REFLECT AND APPLY Give the DNA sequence for the...Ch. 13 - Prob. 43RE Ch. 13 - Prob. 44RE Ch. 13 - Prob. 45RE Ch. 13 - Prob. 46RE Ch. 13 - Prob. 47RE Ch. 13 - RECALL Has proteomic analysis been done on...Ch. 13 - Prob. 49RE Ch. 13 - Prob. 50RE Ch. 13 - Prob. 51RE Ch. 13 - RECALL What are the key differences between DNA...

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

RECALL Why do restriction endonucleases not hydrolyze DNA from the organism that produces it?

Solution Summary: The author explains that restriction endonuclease does not hydrolyze DNA from the organism that produces it, because it has been methylated.

Concept explainers

Videos

Want to see the full answer?

Chapter 13 Solutions