Biochemistry
9th Edition
ISBN: 9781305961135
Author: Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 13, Problem 36RE
REFLECT AND APPLY What difficulties arise in the polymerase chain reaction if there is contamination of the DNA that is to be copied?
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
(recall) During DNA replication one nucleotide strand is used as a template for polymerization of another. What WOULD BE THE NUCLEOTIDE (?) in the newly synthesized complementary DNA chain across
from the nucleotide C
template ATGCAGCTCCAGTCGGTAATG
new strand
O none of answers correct
O Tor A
O A
Chapter 13 Solutions
Biochemistry
Ch. 13 - RECALL What advantages does fluorescent labeling...Ch. 13 - RECALL What methods are used to visualize...Ch. 13 - REFLECT AND APPLY When proteins are separated...Ch. 13 - RECALL How does the use of restriction...Ch. 13 - RECALL What is the importance of methylation in...Ch. 13 - RECALL Why do restriction endonucleases not...Ch. 13 - Prob. 7RECh. 13 - Prob. 8RECh. 13 - RECALL What do the following have in common? MOM;...Ch. 13 - RECALL Give three examples of DNA palindromes.
Ch. 13 - RECALL What are three differences between the...Ch. 13 - RECALL What are sticky ends? What is their...Ch. 13 - RECALL What would be an advantage of using HaeIII...Ch. 13 - RECALL Describe the cloning of DNA.Ch. 13 - RECALL What vectors can be used for cloning?Ch. 13 - RECALL Describe the method you would use to test...Ch. 13 - RECALL What is blue/white screening? What is the...Ch. 13 - Prob. 18RECh. 13 - Prob. 19RECh. 13 - Prob. 20RECh. 13 - Prob. 21RECh. 13 - Prob. 22RECh. 13 - Prob. 23RECh. 13 - REFLECT AND APPLY What are the requirements for an...Ch. 13 - Prob. 25RECh. 13 - Prob. 26RECh. 13 - REFLECT AND APPLY The genes for both the a- and...Ch. 13 - REFLECT AND APPLY Outline the methods you would...Ch. 13 - Prob. 29RECh. 13 - Prob. 30RECh. 13 - Prob. 31RECh. 13 - Prob. 32RECh. 13 - RECALL Why is temperature control so important in...Ch. 13 - RECALL Why is the use of temperature-stable DNA...Ch. 13 - RECALL What are the criteria for good primers in a...Ch. 13 - REFLECT AND APPLY What difficulties arise in the...Ch. 13 - REFLECT AND APPLY Each of the following pairs of...Ch. 13 - RECALL What is qPCR?Ch. 13 - Prob. 39RECh. 13 - REFLECT AND APPLY Suppose that you are a...Ch. 13 - REFLECT AND APPLY Why is DNA evidence more useful...Ch. 13 - REFLECT AND APPLY Give the DNA sequence for the...Ch. 13 - Prob. 43RECh. 13 - Prob. 44RECh. 13 - Prob. 45RECh. 13 - Prob. 46RECh. 13 - Prob. 47RECh. 13 - RECALL Has proteomic analysis been done on...Ch. 13 - Prob. 49RECh. 13 - Prob. 50RECh. 13 - Prob. 51RECh. 13 - RECALL What are the key differences between DNA...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- REFLECT AND APPLY In the MeselsonStahl experiment that established the semiconservative nature of DNA replication, the extraction method produced short fragments of DNA. What sort of results might have been obtained with longer pieces of DNA?arrow_forwardREFLECT AND APPLY (a) Eukaryotic DNA replication is more complex than prokaryotic replication. Give one reason why this should be so. (b) Why might eukaryotic cells need more kinds of DNA polymerases than bacteria?arrow_forwardREFLECT AND APPLY Your book contains about 2 million characters (letters, spaces, and punctuation marks). If you could type with the accuracy with which the prokaryote E. coli incorporates, proofreads, and repairs bases in replication (about one uncorrected error in 109to1010 bases), how many such books would you have to type before an uncorrected error is permitted? (Assume that the error rate is one in 1010 bases.)arrow_forward
- REFLECT AND APPLY What is the complete base composition of a double-stranded eukaryotic DNA that contains 22% guanine?arrow_forwardREFLECT AND APPLY Give the DNA sequence for the template strand that gives rise to the following sequence gel, prepared using the Sanger method with a radioactive label at the 5' end of the primer.arrow_forwardREFLECT AND APPLY Suggest a reason why it would be unlikely for replication to take place without unwinding the DNA helix.arrow_forward
- RECALL What are the key differences between DNA microarrays and protein microarrays, and how they are used in research?arrow_forwardREFLECT AND APPLY When proteins are separated using native gel electrophoresis, size, shape, and charge control their rate of migration on the gel. Why does DNA separate based on size, and why do we not worry much about shape or charge?arrow_forwardRECALL Why is the use of temperature-stable DNA polymerase an important factor in the polymerase chain reaction?arrow_forward
- REFLECT AND APPLY Some viruses can undergo lysis or lysogeny even in the same host. What might be a reason for this? Under what conditions might the virus favor the one strategy over the other?arrow_forwardREFLECT AND APPLY Define processivity, and indicate the importance of this concept in DNA replication.arrow_forwardREFLECT AND APPLY The genes for both the a- and b-globin chains of hemoglobin contain introns (i.e., they are split genes). How would this fact affect your plans if you wanted to introduce the gene for a-globin into a bacterial plasmid and have the bacteria produce a-globin?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biomolecules - Protein - Amino acids; Author: Tutorials Point (India) Ltd.;https://www.youtube.com/watch?v=ySNVPDHJ0ek;License: Standard YouTube License, CC-BY