
Concept explainers
(a)
To determine:
The muscle used to pull the stalled car.
Introduction:
Muscles of the pectoral girdle are of two types, anterior group muscle and posterior group muscle. The anterior group contains two muscles, pectoralis minor and serratus anterior. The pectoralis minor arises from the 3-5 ribs, while, the serratus anterior arises from most of the ribs. The posterior group contains three deep muscles, the rhomboid minor, the rhomboid major, and levator scapulae.
(b)
To determine:
The muscle used in paddling the canoe.
Introduction:
Muscles of the pectoral girdle are of two types, anterior group muscle and posterior group muscle. The anterior group contains two muscles, pectoralis minor and serratus anterior. The pectoralis minor arises from the 3-5 ribs, while, the serratus anterior arises from most of the ribs. The posterior group contains three deep muscles, the rhomboid minor, the rhomboid major, and levator scapulae.
(c)
To determine:
The muscle that is used in squaring the muscle during military action.
Introduction:
Muscles of the pectoral girdle are of two types, anterior group muscle and posterior group muscle. The anterior group contains two muscles, pectoralis minor and serratus anterior. The pectoralis minor arises from the 3-5 ribs, while, the serratus anterior arises from most of the ribs. The posterior group contains three deep muscles, the rhomboid minor, the rhomboid major, and levator scapulae.
(d)
To determine:
The muscle used to lift the shoulder to carry a heavy box on it.
Introduction:
Muscles of the pectoral girdle are of two types, anterior group muscle and posterior group muscle. The anterior group contains two muscles, pectoralis minor and serratus anterior. The pectoralis minor arises from the 3-5 ribs, while, the serratus anterior arises from most of the ribs. The posterior group contains three deep muscles, the rhomboid minor, the rhomboid major, and levator scapulae.
(e)
To determine:
The muscle used to lower the shoulder to grasp the suitcase.
Introduction:
Muscles of the pectoral girdle are of two types, anterior group muscle and posterior group muscle. The anterior group contains two muscles, pectoralis minor and serratus anterior. The pectoralis minor arises from the 3-5 ribs, while, the serratus anterior arises from most of the ribs. The posterior group contains three deep muscles, the rhomboid minor, the rhomboid major, and levator scapulae.

Want to see the full answer?
Check out a sample textbook solution
Chapter 12 Solutions
Human Anatomy
- How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forward
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Fundamentals of Sectional Anatomy: An Imaging App...BiologyISBN:9781133960867Author:Denise L. LazoPublisher:Cengage LearningLifetime Physical Fitness & WellnessHealth & NutritionISBN:9781337677509Author:HOEGERPublisher:Cengage
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College


