
Concept explainers
One of the autosomal loci controlling eye color in fruit flies has two alleles: one for brown eyes and the other for red eyes. Fruit flies from a true-breeding line with brown eyes were crossed with flies from a true-breeding line with red eyes. The F1 flies had red eyes. What conclusion can be drawn from this experiment? (a) these alleles underwent independent assortment (b) these alleles underwent segregation (c) these genes are X-linked (d) the allele for red eyes is dominant to the allele for brown eyes (e) all the preceding are true

Introduction: Locus (pl:loci) is the specific location of the gene in the chromosome. Alleles are variants of a gene. The allele that masks the expression of the other allele in heterozygous form is called the dominant allele.
Answer to Problem 1TYU
Correct answer: When fruits flies of true-breeding line with brown eyes are crossed with fruits flies of true-breeding line with red eyes, the F1 had red eyes that show that the allele for red eyes is dominant to the allele for brown eyes. Therefore, option (d) is correct.
Explanation of Solution
Reason for the correct answer.
When true breeding parents are crossed where one parent is homozygous for one allele and the other parent is homozygous for another allele, the trait expressed in the F1 generation is the dominant allele. When applying the above principle for the given question, where fruits flies of true-breeding line with brown eyes are crossed with fruits flies of true-breeding line with red eyes, the F1 will have red eyes. This shows that the allele for red eyes is dominant to the allele for brown eyes.
Option (d) is given as “the allele for red eyes is dominant to the allele for brown eyes”.
When fruits flies of true-breeding line with brown eyes are crossed with fruits flies of true-breeding line with red eyes, the F1 will have red eyes that show that the allele for red eyes is dominant to the allele for brown eyes. Therefore, option (d) is correct.
Reasons for the incorrect statements.
Option (a) is given as “these alleles underwent independent assortment”.
Independent assortment can be explained with two traits only. Here, only one trait is mentioned, that is eye color, therefore, they can show only segregation, not independent assortment. Hence, option (a) is incorrect.
Option (b) is given as “these alleles underwent segregation”.
This option is correct, yet the most suitable option will be option (d) as the law of segregation has proved right for single traits. This experiment reveals the dominant allele more than segregation. Hence, option (b) is incorrect.
Option (c) is given as “these genes are X-linked”.
The question mentions that these alleles are present in autosomal loci and therefore, they cannot be X-linked. Hence, option (c) is incorrect.
Option (e) is given as “all the preceding are true”.
Option (d) is the most suitable answer followed by option (b). The other options are incorrect. Hence, option (e) is incorrect.
Hence, options (a), (b), (c), and (e) are incorrect.
When fruits flies of true-breeding line with brown eyes are crossed with fruits flies of true-breeding line with red eyes, the F1 will have red eyes that show that the allele for red eyes is dominant over the allele for brown eyes.
Want to see more full solutions like this?
Chapter 11 Solutions
Biology (MindTap Course List)
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College





