Concept explainers
Videos
The expression of a gene may depend on _______.
- a. the type of organism
- b. environmental conditions
- c. the type of cell
- d. all of the above
Concept introduction: Genes are the fundamental units of heredity, which are composed of DNA. Each gene specifies a particular protein. For this, the genes will be converted into a useful product through the process of gene expression. Gene expression involves the conversion of DNA into RNA through the process of transcription. Then, this RNA will be converted into proteins through the process of translation.
Answer to Problem 1SQ
Correct answer: The expression of a gene may depend on the type of organism, environmental conditions and the type of cell.
Therefore, option d. is correct.
Explanation of Solution
Reason for the correct statement:
The gene expression depends upon many factors including the type of organism, environmental conditions and the cell type.
Based upon the type of organism (simple and complex) the gene expressions vary.
Every cell has its own environmental conditions which contain the proteins. Depending upon the location of each of these proteins, the gene expressions may vary.
There are many types of cells that perform different specialized functions. Each cell will adjust to the metabolism by adjusting the gene expression. Also, the multicellular organisms will modify their body structure and function by regulating the gene expression.
Hence, option d. is correct.
Reasons for the incorrect statements:
Option a. is given as, “the type of organism”.
The organisms can be simple or complex depending upon their physiology and anatomical organization. Based upon the type of organism, the gene expressions vary. The given option is correct but the gene expression also depends upon the environmental conditions and the type of cell.
Hence, option a. is incorrect.
Option b. is given as, “environmental conditions”.
Every cell has its own environmental conditions (extracellular and intracellular conditions) which contain the proteins. Depending upon the location of each of these proteins, the gene expressions may vary. The given option is correct but the gene expression also depends upon the type of organism and the type of cell.
Hence, option b is incorrect.
Option c. is given as, “the type of cell”.
There are many types of cells that perform different specialized functions. Each cell will adjust to the metabolism by adjusting the gene expression. The given option is correct but the gene expression also depends upon the environmental conditions and the type of organism.
Hence, option c. is incorrect.
Hence, options a., b., and c. are incorrect.
Want to see more full solutions like this?
Chapter 10 Solutions
Biology: The Unity and Diversity of Life (MindTap Course List)
- DNA methylation is A. heritable and generally activates gene expression. B. heritable and generally represses gene expression. C. not heritable and generally represses gene expression. D. not heritable and generally activates gene expression.arrow_forwardProteins range in size from ~50 amino acids to more than 1,000 amino acids. Given that the typical amino acid is about the same size as a nucleotide, the gene and mRNA for a protein will be ______ that protein. A. smaller than B. larger than C. about the same size as D. there is no way to tellarrow_forwardOperons______ . a. only occur in bacteria b. include multiple genes c. involve selective gene expressionarrow_forward
- Choose the answerarrow_forwardMutations ________. a. are always bad b. have variable impacts c. are usually beneficialarrow_forwardwhich of these describes the symptoms of the disease(s) caused by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? Select all that apply a. Thread-like blood vessels in eyes b. Excessive bleeding c. Dwarfism d. UV light sensitivity e. sunburn f. Bruisesarrow_forward
- Which of the following statements about genes is incorrect? Select one: O a. During fertilization, both the sperm and the ovum contribute genes to the resulting fertilized egg. b. Genetic differences can result from changes in the DNA called mutations. O c. Genes correspond to segments of DNA. d. Under normal circumstances, each chromosome contains precisely one gene. e. Many genes contain the information needed for cells to synthesize enzymes and other proteins.arrow_forwardMechanisms that govern gene expression do not operate during______ . a. transcription c. translation b. RNA processing d. knockoutsarrow_forwardAt birth a child has got blue eyes, but now his/her eyes turn brown. Which of the following statements would best explain the observed phenomena? A. The child does not have brown pigment at birth B. Eye’s colour at birth is affected by mother’s gene C. Gene repressor for brown pigment produced is not yet active D. Gene activatior for brown pigment production is not yet active at birth E. All of the above statements are falsearrow_forward
- A nerve cell and a skin cell from the same person have Group of answer choices A. different gene expression B. different versions of genes C. same gene expression D. none of the above E. different genesarrow_forwardWhich of the following statament is NOT TRUE about gene expression?a. The expression of genes that code for proteins includes two stages: replication and translationb. Translation is the synthesis of a polypeptide using the information in the mRNA.c. During gene expression, the information encoded in genes is used to make specific polypeptide chains or RNA molecules.d. Gene expression is the process by which DNA directs the synthesis of proteinsarrow_forward8) Which of these describes the function of RNA polymerase? A. Amplifies the “message" by making multiple copies of an mRNA molecule after it has been transcribed from DNA B. Converts a protein sequence to mRNAarrow_forward
