You have four tubes with buffer, primer, DNA polymerase, template, and dNTP's. In tube A, you have added radioactive ddATP at a ratio of 1 ddATP/100 dATP. In tube T, you have added radioactive ddTTP at a ratio of 1 ddTTP/100 dTTP. In tube G, you have added radioactive ddGTP at a ratio of 1 ddGTP/100 dGTP. In tube C, you have added radioactive ddCTP at a ratio of 1 ddCTP/100 dCTP. Here is a picture of the template and based paired primer. Each tube has millions of these base paired constructs. 5' - CTAGTACTGA 3' - GATCATGACTGGACTTTGGACTAGCTACAAAGTACGAGTAGAACTAGC After allowing for DNA synthesis and after denaturing the double strand DNA and after separating the single strand DNA by size in a polyacrylamide gel with the A, T, G, and C tube contents in separate lanes, and after performing autoradiography, you detect bands in the A, T, G, and C lanes. In which lane do you expect to see the smallest band?
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
You have four tubes with buffer, primer, DNA polymerase, template, and dNTP's. In tube A, you have added radioactive ddATP at a ratio of 1 ddATP/100 dATP. In tube T, you have added radioactive ddTTP at a ratio of 1 ddTTP/100 dTTP. In tube G, you have added radioactive ddGTP at a ratio of 1 ddGTP/100 dGTP. In tube C, you have added radioactive ddCTP at a ratio of 1 ddCTP/100 dCTP. Here is a picture of the template and based paired primer. Each tube has millions of these base paired constructs.
5' - CTAGTACTGA
3' - GATCATGACTGGACTTTGGACTAGCTACAAAGTACGAGTAGAACTAGC
After allowing for DNA synthesis and after denaturing the double strand DNA and after separating the single strand DNA by size in a polyacrylamide gel with the A, T, G, and C tube contents in separate lanes, and after performing autoradiography, you detect bands in the A, T, G, and C lanes. In which lane do you expect to see the smallest band?
The G lane
The C lane
The A lane
The T lane
asap please.
Step by step
Solved in 2 steps
