Write the complementary strand for each of the following strands of DNA. Part 1 of 4 5'-TTCGAAAA-3' 3'- -5' ☑ Part 2 of 4 5'-CATACACG-3' 3'- -5' ☑ Part 3 of 4 5'-CAGGCTAGTTC-3' 3'- -5' ☑ Part 4 of 4 5'-GATTTAAAAGG-3' 3'- -5' Х
Q: Below is a sample of a segment of DNA…(copy from left to right) 3’…
A: Mutation It occurs when a DNA gene is changed in such a way as to alter the genetic message carried…
Q: Answer the following: DNA fragment A is 3' AGC CCG CTC CGA GGC TAA AAG CGT 5' 1. is % of guanine…
A: The central dogma of life is that DNA self replicates to form its own copies. The copied DNA is…
Q: Strand 1: C-G-T-A-T-C-T-C-A-T-A-G-C-TStrand 2 : A-A-A-G-A-T-A-T-C-A-C-C-C-AStrand 3 :…
A: The central dogma of molecular biology is that the DNA first undergoes replication to make a copy of…
Q: The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, and Non-template strand = 5' - ATGTCGTGAGTCAGT - 3' .…
A: DNA, short for deoxyribonucleic acid, is a nucleic acid molecule made up of a sugar called…
Q: What is the mRNA coded by this template DNA strand? DNA Template Strand: 3' ATGGTACGGTCG 5'…
A: A codon is known to code by three different types of bases in a particular mRNA. Hence, a codon is…
Q: Take each of the DNA sequences and complete ALL of the following steps: i. Find the DNA Replication…
A: A set of guidelines known as the genetic code controls how genetic information is converted from DNA…
Q: Which of the following sequences would be complementary to a DNA strand with the sequence…
A: Complementarity refers to a relationship between two structures each following lock and key…
Q: Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change…
A: Mutations are the abrupt changes in the DNA sequences due to wrong reading of the DNA polymerase…
Q: Look at the double-stranded segment of DNA shown below. Imagine that the two strands have already…
A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…
Q: What is the RNA transcript that would result from the double stranded DNA segment shown below?…
A: Gene expression is mostly dependent on the transcription process, which creates RNA from a DNA…
Q: ents the biochemical reaction that occurs durin
A: Introduction:- DNA synthesis is the biological process by which a deoxyribonucleic acid(DNA)…
Q: Give the corresponding strand of the DNA having the sequence of: a. 5’…
A: DNA(deoxyribonucleic acid) is the heredity material for most living organisms. It is composed of…
Q: If you had the RNA sequence below: 5' UUUGGAG3 and you were going to make a piece of DNA that would…
A: Uracil is the unique base in RNA, whereas in DNA it is thymine.. The strands runs antiparallel; one…
Q: 3. Which of the following two molecules of DNA melts (into single strands) at a lower temperature…
A: Melting of double-stranded DNA into single strands depends on the GC content of DNA that is number…
Q: The coding strand has the following sequence. Please answer the questions below with regard to this…
A: The coding strands run in 3' to 5' direction and has codons it is transcribed as it is in the mRNA…
Q: 5' GTGCTAGCGGGAATGAGCTGGGATACTAGTAGGGCT 3 33' САCGATCGCCCTTACТCGАСССТАТGATCАТССCGA 5' Template…
A: The DNA or deoxyribonucleic acid is the genetic material in living organisms. DNA contain genes that…
Q: Give the DNA compliment to the following DNA strand. GTA SMH UUU GUA CAT
A: In DNA replication, the rule of complementarity is as follows- 1. Adenine (A) and Thymine (T) are…
Q: .1. Give the complete complimentary bases of the parent DNA strand according to Chargaff's rule and…
A: The Chargaff’s rule state that the quality of the nitrogenous base pairs in the DNA is always equal.…
Q: (iij If one of the strands of DNA has the following sequence of bases running in the 5'3' direction…
A:
Q: 1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: You will start off by laying out your individual nucleotides for the first strand using the…
A: DNA is a macro molecule or a polymer which is made up of a monomer called nucleotides. Each…
Q: The following is a section of DNA removed from a cell nucleus: 5'…
A: The basic physical and functional unit of heredity is the gene. DNA is the material that makes up…
Q: One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base…
A: Introduction DNA is the molecular structure that is composed of a pair of polynucleotide chains…
Q: Two base pairs of double-stranded DNA are shown in the figure. Use your knowledge of base structure,…
A: DNA In DNA there are 4 bases Adenine, Thymine, guanine and cytosine. Adenine binds with Thymine…
Q: The sequence of part of an mRNA transcript is What is the sequence of the DNA coding strand? 5'- 5'…
A: DNA is double stranded & during replication both of its strands unwind to produce single…
Q: One DNA strand has the sequence 5' -ATTCCGTAGC-3' what is the complementary strand sequence?
A: DNA ( Deoxyribonucleic acid ) is two stranded structure which act as genetic material in most of the…
Q: What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGELLGTATAL -5…
A: DNA replication :- It is the formation of a new DNA from a pre existing DNA. The DNA so formed is…
Q: Express the following DNA nucleotide bases into amino acids.
A: DNA is first transcribed into mRNA and then translated to amino acids. In transcription, it follows…
Q: Please write the sequence of the mRNA transcript transcribed from the given DNA double helix by…
A: Transcription is the process by which the information contained in DNA is converted into a…
Q: EcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3'…
A: The DNA is formed of several repeating units of monomers called nucleotides. The adjacent…
Q: 5’ TAAGCGTAACCCGCTAA CGTATGCGAAC GGGTCCTATTAACGCAC 3’ 3’ ATTCGCATTGGGCGATT GCATACGCTTG…
A: The DNA is a double stranded molecule which are paired along with a complimentary strand. The above…
Q: Consider a portion of double-stranded DNA with the complementary sequence of base pairs shown. Write…
A: DNA is genetic material in most of living organisms. There are four nitrogenous bases present in…
Q: Draw the following strands of DNA 5’ C-A-T 3’ as well as the complementary base pairing strand…
A: Two strands of DNA twist around one another to form a double helix DNA and both are in anti-parallel…
Q: sing the genetic code provided what would be the corresponding polypeptide sequence for the DNA…
A: The DNA is transcribed into the RNA by the process of transcription and the RNA is translated into…
Q: How many hydrogen bonds exist between this DNA strand and its complementary strand? 5'-TTAGGAG-3'
A: DNA strands are boned together with the help of hydrogen bonds present between the base pairs. These…
Q: In which direction does DNA polymerase synthesize the lagging strand?
A: Lagging Strand: A single DNA strand known as the lagging strand is reproduced in the 5′ - 3′…
Q: I have a question I'm not sure about here it is...... If a short sequence of DNA is…
A: The Correct option is 2.DNA (deoxyribonucleic acid) is a double stranded molecule in which the two…
Q: Draw the following structure. 1)A single strand of DNA with the sequence 5' GCAT 3'
A: Sure, here's a simple representation of a single strand of DNA with the sequence 5' GCAT 3': 5' G…
Q: How many hydrogen bonds exist between this DNA strand and its complementary strand? 5'-CACGGGG-3'
A: Deoxyribonucleic acid (DNA) is a double stranded polynucleotide coiled around a central axis to form…
Q: Given the DNA template strand 3' GCATTCAAG 5', write the amino acid sequence in the N‑terminal to…
A: Amino acids are the basic units (monomers) that makeup proteins. They consolidate to frame short…
Q: All guanines in the top strand of following sequence undergo a chemical change so that they now pair…
A: Two identical DNA molecules, each made up of one original strand (the template strand) and one…
Q: Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA:…
A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…
Q: Give the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCT
A: By the process of transcription the DNA strand is transcribed into mRNA within the nucleus of the…
Q: ’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ Fill in the complimentary DNA strand and…
A: Watson and Crick elucidated in 1953 , the famous double stranded structure of the DNA molecule and…
Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:…
A: Central dogma refers to the process by which information stored in a DNA molecule is converted into…
Step by step
Solved in 2 steps
- Given the following template DNA strand, what is the correct complementary DNA sequence? 3' CGC AGT GGA CAT TTC 5'Given the following template DNA strand, what is the correct complementary DNA sequence? 3' CGC AGT GGA CAT TTC 5' O 5' GCG TCA CCT GTA AAG 3' O 5' GAA ATG TCC ACT GCG 3' O 5' GCG UCA CCU GUA AAG 3' O 5' GAA AUG UCC ACU GCG 3'What is the sequence of a newly synthesized DNA segment if the template strand has each of the following sequences? Part 1 of 4 3'-AGTGTAAC-5' 5'- -3' Part 2 of 4 5'-GGCGACG-3' 3'- -5' Part 3 of 4 3'-TCCTCCCCA-5' 5'- -3' Part 4 of 4 5'-ATGCATCAAC-3' 3'- -5'
- Give the complete complimentary bases of the parent DNA strand according to Chargaffs rule and Identify the names of all the genetic codes.Write the complementary strand to the following single-stranded DNA and label the 5' and 3' ends: 5'-ATAGCATGGGCCATACGATTACTGA-3'Give the complimentary DNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Give the RNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Using the provided amino acid table and the RNA strand you created in #2, create the amino acid sequence: Name and explain two different ways in which DNA can be damaged. Once DNA is damaged, can we repair it? If not, what are some possible outcomes from the damaged DNA?
- Write down the double stranding sequence of the resulting DNA fragment(s) if the following DNA molecule were digested with XhoI: 5'-GGTATCCGCGGAGCTCAAATA-3' 3'-CCATAGGCGCCTCGAGTTTAT-5'5’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ Fill in the complimentary DNA strand and label the polarity (the 5’ and 3’ ends)DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’a. what is the non-template/sense/coding strand?b. What is the arrangement of the m-RNA?c. What's the chain arrangement of the amino acids that will be made according to the order of the RNA?d. If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed?e. What's the chain arrangement of the amino acids produced by this mutation?
- Below is a depiction of a replication bubble. 5' AGCTCCGATCGCGTAACTTT 3' TCGAGGCTAGCGCATTGAAA CTAAAGCTTCGGGCATTATCG 3' GATTTCGAAGCCCGTAATAGC TATCGACS Consider the following primer which binds to the DNA replication bubble on the diagram above: 5'-GCUAUCG-3' Identify the DNA sequence to which this primer would bind and the orientation. If the replication fork moves to the right, will the primer be used to create the leading strand of replication or the lagging strand? Explain your answer b. If the replication fork moves to the left, will the primer be used to create the leading strand of replication or a. the lagging strand? Explain your answer. What would the next five nucleotides added to the primer by DNA polymerase? С.I have a question I'm not sure about here it is...... If a short sequence of DNA is 5’-CGTAATCGGATC-3’, its complementary RNA strand is The answers given are: 5’- GCAUUAGCCUAG -3’. 5’- GAUCCGAUUACG - 3’. 5’-GATCCGATTACG - 3’. 5’-GCATTAGCCTAG - 3’.please dont give hand writting solution please