How many hydrogen bonds exist between this DNA strand and its complementary strand? 5'-CACGGGG-3'
Q: What will be the result for each qualitative test if the intact casein contains the following…
A: Protein qualitative tests are test used to estimate the proteins qualitative way, i.e. it identifies…
Q: Why is cholesterol an important steroid?.
A: Cholesterol is a steroid. a steroid is a compound having a cyclopentanoperhydrophenanthrene (CPPP)…
Q: 2. The mechanism of HMG-CoA reducatse enzyme activity involves several stages. For the catalytic…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: C. TBARS Assay 1. In a test tube, mix 1 mL of the samples and 1 mL of thiobarbituric acid reagent.…
A: Sources of error can be defined as the factors which affect the accuracy and precision of an assay.…
Q: Which of the following describes the interaction between the amino acid last eluted and the anion…
A: In Ion exchange chromatography the molecules are separated according to their charge. The matrix…
Q: 1.1 Explain in detail, the diagrams in terms of the principle of bioenergetics. WAK products А…
A: Bioenergetics is the field in biochemistry that concerns how cells transform energy and hence…
Q: 4. Blood glucose level, glucose transporter proteins (classification, localisation and biological…
A: Blood Glucose is the major sugar found in our blood.It is the main source of energy used by a cell.…
Q: Vasopressin is a hormone that plays an important role in social behavior, sexual motivation, and…
A: Recall that: Amino acid sequences are written with N-terminal amino acid on the left and…
Q: In the last stage of cellular respiration (ETS and oxidative phosphorylation) what is the fate of…
A: ETS (Electron Transport System) is a sequential arrangement of proteins (Protein complexes I, II,…
Q: 1. The lactose operon is controlled by both lactose and glucose. Fill in the following table to…
A: The lactose operon is a catabolic operon in Ecoli that encodes proteins that are necessary for the…
Q: 4. Identify: for nos. 1-5: Name of the missing metabolite in the pathway 6-10: Enzyme that catalyzed…
A: Catabolism is the breakdown of complex substances into simpler molecules, while anabolism is the…
Q: B PART III Multiple choice 16. What is a protein's primary structure? a.) polypeptide sequence (b)…
A: A living cell is the basic unit of life. It is capable of independent existence (as is the case of…
Q: 9) Covalent modification is a versatile tool used to regulate enzyme activity. Discuss three…
A: Enzyme regulation by Covalent transformations is by altering the synthesized proteins either by…
Q: skimmed milk pasteurized milk evaporated milk condensed milk fortified milk…
A: Milk is a biological respiratory fuel synthesized by the mammary glands of mammals to nourish their…
Q: For class I MHC, which of the following statements are correct? P. They are expressed on all…
A: MHC are proteins encoded by a huge complex of genes called the major histocompatibility complex…
Q: Using proper convention, provide the amino acid sequence for the following protein. O H₂N-CH- CH₂…
A: Proteins are large molecules made up of amino acid residues linked via a peptide bond. Amino Acids…
Q: The diagram below describes: A) How the pumping of sodium ions out of the cell can power the…
A: The biological membrane that surrounds a living cell is called the cell membrane. The structure of…
Q: Use the relationships revealed by a Lineweaver-Burk plot and the table of enzyme performance to…
A: Parameters such as Km and Vmax are used for comparing enzyme activities. If we know the initial rate…
Q: De novo synthesis of nucleotides is an energy intensive process and therefore not always the…
A: Nucleotides are phosphorylated nucleosides. Phosphorylated nucleosides are known as nucleotides. A…
Q: A competitive inhibitor diminishes the rate of catalysis: A) By reducing the proportion of enzyme…
A: The enzymes are biological catalysts that increases the rate of biological reactions. The enzymatic…
Q: True or false: The contributions to the change in Gibbs free energy of binding for a lipid ligand in…
A: Though the biological membrane is primarily composed of lipid bilayer, membrane proteins perform…
Q: Below is the skeletal formula of a molecule typically found in cell membranes. What type of molecule…
A: The biological membrane that surrounds a living cell is called the cell membrane. The structure of…
Q: Carbohydrates that appear in glycosylated proteins and lipids in the GA include I.…
A: Golgi do post-translational modifications in protein. Such as attaching carbohydrates with…
Q: Give a CHEMICAL test that can differentiate the pair of sugars and give the results for both. No…
A: Introduction: Carbohydrate is an important source of energy that is important for all living…
Q: Give the systematic name for the disaccharide shown in the image by selecting the appropriate terms.…
A: Conformation is the different positions a molecule can twist into. Configuration is the arrangement…
Q: is it true that aplha and beta are made up of same amino acids but Beta chain is longer than alpha…
A: Hemoglobin (Hb) is a complex protein which is consist of two parts - the heme and the globin. Heme…
Q: An ion exchange resin prefers calcium over magnesium, indicated by Xcalcium = 0.6 and Ymagnesium =…
A: An ion-exchange resin or ion-exchange polymer is a insoluble resin or polymer that acts as a matrix…
Q: The following is a block diagram for a sphingophosph lipid where the building blocks are labeled…
A: Biological lipids are a chemically diverse class of organic compounds that are either insoluble or…
Q: The TPOX locus is one of the genetic loci used for forensic analysis of DNA. The TPOX locus has the…
A: Forensics DNA profiling can be used to solve old or unsolved crimes and to identify the person…
Q: Which of the following B vitamins is used in the conversion of pyruvate to oxaloacetate? Biotin…
A: Different forms of Vitamin B act as cofactors in many enzyme catalyzed steps. Conversion of…
Q: 1. The enzyme you are studying uses the substrate pictured at right. An inhibitor box in the freezer…
A: Enzyme inhibition is when a inhibitor bind to the enzyme at the active site or another site, which…
Q: The textbook author admits the number of protons pumped from the matrix to inter-membrane space by…
A: Given that the number of protons pumped per NADH molecules is 10 and 6 for FADH2. Also, 3 protons…
Q: in triacylglycerol mobilization, triacylglycerol molecules is activated by: phosphorylation…
A: Triacylglycerol are esters of fatty acid and glycerol. Triacylglycerol, as the name indicates,…
Q: The ff: table showed data of enzyme catalytic reaction. The rate of reaction (v) decreased with the…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: When the movement of lipids in biological membranes was measured, it was observed that: A) Saturated…
A: The cell membrane is a phospholipid bilayer. According to the Fluid Mosaic Model, the cell membrane…
Q: How much energy is required to synthesize a saturated C12 fatty acid? How does this compare with the…
A: Fatty acid synthesis occurs in the cytosol of all eukaryotic cells except plants (occurs in…
Q: If glucose labeled with 14C in C-3 were metabolized by glycolysis, pyruvate would be labeled in: a.…
A: Glycolysis is the metabolic pathway by which 6 carbon glucose is converted into 3 carbon pyruvate in…
Q: Which of the following is a ketone body? O Pyruvate Acetoacetic acid O Lactic acid O Glycogen
A: Ketone bodies contain ketone groups and are produced in the liver from fatty acids. The process of…
Q: The structures are tautomers of nucleotide bases. Identify each base. OH Base: OH ☆ Base: Base: "OH…
A: Nucleic acids are composed of nucleotides (sugar, nitrogenous base & phosphate group). Nucleic…
Q: Question 14 The first three amino acids in a protein are lysine, glutamine, and serine. T describes…
A: The four classes of biological macromolecules are proteins, nucleic acids, carbohydrates and lipids.…
Q: The textbook author admits the number of protons pumped from the matrix to inter-membrane space by…
A: Oxidative Phosphorylation: In a sequence of redox reactions, electrons are transferred from one…
Q: 3. In the experiment shown below, researchers looked at the effects of glucose-free medium on…
A: Glutamate is an amino acid that is synthesized from glutamine and through the transamination of…
Q: The following are coenzymes or cofactors involved in enzymatic reactions. Identify the biochemical…
A: Enzymes are biological catalysts that increases the rate of biochemical reactions. Most enzymes are…
Q: Two proteins bind to the same ligand with the following Kd's. Protein 1: 10 μΜ Protein 2: 100 nM…
A: Consider the following reaction: P + L ⇌k2k1 PL where P is the protein, L is the ligand and k1 and…
Q: Primer design worksheet T7 Promoter Kpn ...KS primer binding site Eco01091 Dra Il BasH II…
A: Polymerase chain reaction (PCR) is a molecular biology technique that can make multiple copies of a…
Q: An analysis is performed to determine the proportions of each of the four nucleotide bases in the…
A: The genetic material in the cells of most organisms is DNA or deoxyribonucleic acid. DNA is…
Q: I. Essay: Explain the following question with the use of illustrations. Briefly describe them with…
A: “Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…
Q: How many ATP will be yielded in 2 moles of an 17:0 and 18:0 carbon chain?
A: Beta oxidation is a process of oxidation of fatty acids into acetyl CoA. The total amount of ATP…
Q: Identify: for nos. 1-5: Name of the missing metabolite in the pathway 6-10: Enzyme that catalyzed…
A: Since you have posted multiple questions, we will provide the solution only to the first five…
Q: Which of the following statements concerning complete protein hydrolysis is incorrect? Primary…
A: Protein hydrolysis is process of breaking down proteins into its components. Hydrolysis reactions…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- How many hydrogen bonds exist between this DNA strand and its complementary strand? 5'-GCGACCG-3"Give the base sequence of the complementary DNA strand of the DNA chain with the following base sequence: 5’ ACGTAG 3’Which of the following single-stranded DNA sequences is most likely to form a stem-loop structure? TAAGTACATTACCCCG ACTTCTTCTCCGCTGC GACCGTATGCACGGTC GCCCACGCCAGTAGTG
- What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence.If one of the strands of DNA has the following sequence of bases running in the 5-S3' direction,5'-G-G-A-C-A-A-T-C-T-G-C-3' what base is closest to the 5'-end in the complementary strand?For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strand
- Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence5'-TATGGCATAC-3'Write the complementary strand to the following single-stranded DNA and label the 5' and 3' ends: 5'-ATAGCATGGGCCATACGATTACTGA-3'Match the following terms with their correct definition. The structure of double-standed DNA Hold the base pairs together and make up the rungs of the DNA double helix One strand of nucleotides running in the opposite direction of the other strand Consists of a phosphate, a sugar backbone, and a nitrogen base A-T and C-G base pairs Five-carbon sugar found in DNA Complementary base pairs Double helix Antiparallel Nucleotide Hydrogen bonds Deoxyribose sugar
- If one strand of DNA has the sequence 5'-C-T-A-G-C-G-T-T-A-3', what sequence would appear opposite it on the other strand? Enter the complementary sequence of letters separated by hyphens. • View Available Hint(s) 3'- 3'-G-A-T-C-G-C-A-A-T-5' -5'One DNA strand has the sequence 5' -ATTCCGTAGC-3' what is the complementary strand sequence?If the sequence of one strand of a DNA molecule is 5’-AGCCCCGACTCTATTC-3’, what is the sequence of the complementary strand?