Which of the sequences below do you think would most likely be found in an intrinsically disordered protein?  GSSKSSKKREPS MVLITTEVKAT MVLITTEVIIAA

Q: The drug, erythropoietin (EPO) is an artificial version of a protein that is naturally produced by…

A: DNA is the double-stranded molecule that is the genetic material in most animals except for some…

Q: A hypothetical protein found in humans, chimpanzees, and orangutans has the following sequences.…

A: Dashes '-' show sequence deletions; underlined variations 'Y' and 'K' between the species indicate…

Q: Sequence: CUCAACACGCCGCUCAGUGCCCUCGUGAUGAAGCAUAGGGGAAAC   By in vitro translating the mRNA, you…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: A small section of a gene for a protein has the following nucleotide sequence: TAT CTG GCT GTC CAA…

A: Mutation is defined as the sudden and permanent change in the nucleotide sequence of DNA.  Missense…

Q: A sample of a peptide of unknown sequencewas treated with trypsin; another sample of the same…

A: Introduction: The chain of amino acids is known as a peptide which is connected by an amine or…

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: A very common molecular biology research method is to analyze cell or tissue homogenates by…

A: In molecular biology research, SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting,…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: You are studying the toxic protein called ectatomin, a major component of ant venom (specifically…

A: Proteins contain amino acids. They are linked to each other by peptide bonds. The amino acid such as…

Q: A common strategy for identifying distantly relatedhomologous proteins is to search the database…

A: Introduction: Bioinformatics is an interdisciplinary field of science that combines biology,…

Q: What is the net charge of the peptide at pH 7 that is synthesized from this DNA sequence? 5'…

A: As we know that the DNA sequence exhibits codons, which helps in the formation of mRNA, and then…

Q: What makes the initiator tRNAmet so special?  Does this have any impact on the amino acid sequence…

A: Protein synthesis is initiated by the start codon decoded by the tRNA. The anticodon triplet series…

Q: The sequences (N-terminal to C-terminal) of the smaller peptides produced by trypsin digestion were…

A: Enzymes can catalyze several reactions and aid in speeding up a reaction. There are several enzymes…

Q: How many base substitutions are there between these sequences? Count ONLY the instances where there…

A: Sequence alignment involves the comparison of sequences of a particular gene from various organisms…

Q: The following RNA: 5 AUGAUAACACUCGUACCUUAAUGUS' in the 5'-3'frame will betranslated into a peptide…

A: The single-stranded ribonucleic acid (RNA) molecule that corresponds to the genetic sequence of a…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: Rice genome contains 30% C on a molar basis. What are the mole percentages of A, G, and T?

A: In a double helical DNA, there are 4 nucleotides are found ATP, GTP, CTP, TTP. In this double…

Q: Is the answer mRNA or Exon?

A: The following are further details about  each option: Exons:Incorrect.Exons are the coding regions…

Q: For the anticodon sequences  5' IAA, consider the DNA sequence of the gene encoding the tRNA, what…

A: Transfer RNA is a RNA which is used in the protein synthesis or translation process. It carries a…

Q: You could use absorbance at 280nm or colorimetric assays like the Bradford assay or bicinchoninic…

A: There are different methods present to measure the concentration of a given protein.

Q: Assume that the translational error frequency, δ, is 1 x 10–4.(a) Calculate the probability of…

A: mRNAs are used to form protein by translation. The translation is performed using ribosomes, t-RNA…

Q: You have discovered a novel protein that has a pl = 5.5. To study the functional properties of this…

A: pI of protein is directly proportional to the pKa of amino acids.

Q: Based on the alignment of these protein sequences below, which [pairs] of the genes appear to be…

A: Based on the alignment of the protein sequences provided in the image, it appears that: SEQUENCE 2…

Q: A recent genome sequencing project for the bacterium Burkholderia mallei has identified a new…

A: The new protein identified here has a partial sequence given as TVEVNAPGDVQKALSELQQINDGRLDIRI…

Q: Which of the following sequences would pair best with this sequence: 5'-CGATTCGA-3' O 5'-UCGAAUCG-3'…

A: In DNA, the nitrogenous bases adenine (A) pairs with thymine (T), and cytosine (C) pairs with…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.