Answered: Which of the following mothers is MOST…

Which of the following mothers is MOST Likely to have a child with hemolytic disease of the newborn? b. Group AB, R1R1 with anti-Lu(a) c. Group B, R2R2 with anti-e d. Group A1, R1r with anti-H

Basic Clinical Laboratory Techniques 6E

6th Edition

ISBN:9781133893943

Author:ESTRIDGE

Publisher:ESTRIDGE

Chapter4: Basic Immunology And Immunohematology

Section4.7: Rh Typing

Problem 3.1CS

See similar textbooks

Related questions

Q: Which of the following is FALSE about fruit? A. Mature ovary B. Protect seeds and aid in dispersal…

A: Introduction : Angiosperms are flowering plants that produce fruits with seeds inside of them. They…

Q: How would a mutation like R167Q within a protein such as Human yD Crystallin affect its function and…

A: A mutation is a change in the DNA sequence of an organism. Mutations can result from errors in DNA…

Q: In detail explain the experiment that helped Hershey and Chase recognize DNA as a genetic material

A: Please follow step 2 for detailed explanation.

Q: What is visible illness and invisible illness ?

A: The distinction is made between the terms disease, illness, and sickness. The term disease literally…

Q: 4. Which structure protects the plant body against the invasion of parasites?

A: Parasites It refers to an organism that lives on or inside a host organism. It obtains sustenance…

Q: If you were sitting quietly in a chair, the time between each of your heart beats would be exactly…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Question:- Why do gametophytes not give rise to spores in bryophytes or ferns?

A: The life cycle of plants show alternation of generation in which the plant body alternates between a…

Q: roblem 1 a) State the different requirements for a disinfectants b) State the advantages and…

A: Disinfection is process of the application of a chemical agent to destroy or inhibit the growth of…

Q: What is geneticization and is it a cause for concern

A: Introduction Genetics is the scientific study of genes & heredity, It is mostly concerned…

Q: Pineal body Arbor vitae lateral ventricle cerebellum 3rd ventricle corpus callosum optic chiasma…

A: It is critical to learn and know the anatomy and physiology of the body. Many changes in the animal…

Q: Explain mechanisms of action in endocrine signaling, taking Adrenalin-induced fight or flight…

A: A complicated system of glands and organs makes up the endocrine system. Body's metabolism, energy…

Q: Living modified organism (LMO) is defined as any living organism that possesses a novel combination…

A: Living modified organism means an organism which genetic materials has been altered artificially…

Q: According to the framework proposed by Blackburn et al. (2011), the term "invasive" applies to a…

A: Invasion biologists focused on various taxa and environments have adopted different model frameworks…

Q: QUESTION 37 A reservoir is O an environment that may contain various pathogenic microbes. O a living…

A: Introduction :- All living and non-living objects that occur naturally, or in this example, without…

Q: In muscle, glycogen phosphorylase is stimulated (activated) by a. Glucose b. AMP c.…

A: Please follow step 2 for detailed explanation.

Q: 10 b. The half-life of polonium-218 is 3.0 min. If you start with 20.0 g, how long will it be before…

A: According to the question The initial concentration is 20g No = 20g The final concentration…

Q: DNAT A C C A C C C C C G T A T G G C T G G G…

A: DNA and RNA acts as a genetic matter that carry the genetic information from one generation to…

Q: Sporadic vs endemic

A: 1.Sporadic disease:Typhoid fever in the United States is an example of a sporadic disease, which is…

Q: Describe either 1) how you would go about making a goat that produces a silk protein (S) in it's…

A: "Transgenic" is an alternative term used for "genetically modified organisms", these are those…

Q: Which is the most important digestive enzyme in gastric juice

A: The most important digestive enzyme in gastric juice is pepsin. Gastric juice is formed in the…

Q: Separation of homologous chromosomes during Meiosis I requires: Select one: a. Removing centromere…

A: A division in which diploid cell reduces the chromosome number into half by cell division and…

Q: Is it possible to perform DNA profiling with SNPs instead of SSRs as DNA markers, but in general you…

A: SNPs are used by geneticists as markers to find genes in DNA sequences. Suppose a gene alteration…

Q: Which is true about O-H bonds? A. They are polar and oxygen is the negative end. B. They are polar…

A: O-H bond contains an oxygen and hydrogen atom and this bond is a single covalent bond that carries a…

Q: Match the proteins to their functions in DNA replication. DNA polymerase RNA polymerase Helicase…

A: Eukaryotic cells' nuclei and prokaryotic cells' nucleoid regions are where DNA replication takes…

Q: Besides plants, animals could also be genetically engineered. Describe TWO (2) transgenic fishes…

A: Transgenic animals are animals that carry a foreign gene. These genes are deliberately introduced…

Q: Based on the data below, how much more UV resistant was B. licheniformis relative to S. aureus? (All…

A: UV radiation cause production of large number of ROS and also get absorbed into DNA thus leads to…

Q: How is GMO negatively impacting the companies that are making GMO?

A: A genetically modified organism (GMO) is any organism whose genetic material has been altered using…

Q: A shuttle vector is a vector (usually a plasmid) different host species. One of the most common…

A: Shuttle vector It refers to the type of vector, often a plasmid designed to spread among two…

Q: In the above diagram, letter C represents: A voltage-gated K+ channel A leaky Na+ channel A leaky K+…

A: The difference between the electric potential across the cell membrane is due to ionic gradient…

Q: Which of the following polypeptides (written from their N terminal ends) is encoded by the following…

A: The genetic code is a set of instructions that enable live cells to produce proteins using genetic…

Q: A mature oak and hickory forest ecosystem experienced an intense forest fire that burned the…

A: A wildfire, also known as a forest fire, bushfire, wildland fire, wildland fire, or rural fire, is…

Q: What would happen if a chromosome didn't have telomeres, or telomerase was faulty?

A: In DNA replication, the DNA unwinds, and the two strands detach at the "replication origins" a…

Q: 32. What are the two components of tRNA which are important for building a protein? what are…

A: Ribosomes are the one of the most essential organelle which is known for synthesis of proteins.…

Q: What are arguments against this plant being a cause of increased cancer incidences (limit 5-6…

A: 1- As Ames test showed positive result it means that the chemical plant polluted the surrounding air…

Q: Genetically modified foods (GM foods) are products produced from organisms that have had genetic…

A: Crops that have had their DNA altered through genetic engineering are referred to as genetically…

Q: A B C Match the action potential phase in the plot below with the correct image below showing the…

A: The transportation of different ions across different membrane transporters (carrier proteins or…

Q: 1. Which of the following is true of a maternal effect? A) The gene is located in the nucleus. B) It…

A: Maternal effect produces when specific phenotypes of offspring are controlled by the factors that…

Q: BHI TTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACT M13-20 primer binding site Bsp 1061 goi Primer design…

A: It is required to use oligonucleotide primers while conducting a PCR reaction. Designing primers…

Q: uence below shows a part of the genetic code for the HBB Gene. This gene provides the instructions…

A: Introduction Sickle cell disease (SCD) is a type of blood disorders that are frequently passed down…

Q: Instructions: Put the following terms into a word map to explain how they are interrelated for DNA…

A: DNA replication is a complex process of producing copies of the entire chromosome using the…

Q: DNAT A C C G C C C C A T G A T G A A T A C C…

A: DNA sequencing is the process of determining the sequence of nucleic acids, which are the basic…

Q: Jackson Wang is a biologist working with the genetics of a thermophilic bacterium. He cloned a heat…

A: Gene cloning is a frequent process in molecular biology labs where researchers make clones of a…

Q: 2) Concerning the figure below. $. 24 ACC GGGUA - AUG 17 lif UAA A) Which process is being…

A: Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum make…

Q: What amino acid does the codon AUG code for? OUAG-methionine (MET) UAC-methionine (MET)…

A: There are 64 possible codons, among them three do not code for any amino acid, known as stop codon.…

Q: A: Microorganisms are ubiquitous B: There are more bacteria than fungus in these plates C: All…

A: The bacteria can be cultured on suitable solid and liquid media. Different types of bacteria also…

Q: The point where separation of the DNA occurs is called the Stranding point True False

A: DNA replication is a biological process through which a single DNA molecule is used to produce two…

Q: A resting cell's membrane is more permeable to K+ simply because: K has a higher atomic number than…

Q: *REQUIRED 23. What are the inputs of the Light Dependent Reaction represented by

Q: Name two traits that primates have that are modified from an ancestral mammalian form (consider:…

A: Primates usually come under mammalian order and is divided into two sub orders prosimians and…

Q: SUBPHYLUM CRUSTACEA Describe the joint motion of the crayfish cheliped (first walking leg). Compare…

A: Introduction :- The characteristics of a crustacean include: a segmented body with a hard exterior…

Concept explainers

Hematology

Hematology is the branch of biology. Hematology is the medical field that deals with the treatment of blood disorders and cancers, such as hemophilia, leukemia, lymphoma, and sickle-cell anemia. Hematologists and hematopathologists are medical professionals who specialize in illnesses of the blood and its components.

Question

Which of the following mothers is MOST Likely to have a child with hemolytic disease of the newborn?

b. Group AB, R1R1 with anti-Lu(a)

c. Group B, R2R2 with anti-e

d. Group A1, R1r with anti-H

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

8) In addition to the ABO self-antigen system, another red blood cell self-antigen system is the Rh factor. The gene for this self=antigen system exhibits complete dominance with Rh positive (the presence of self-antigen Rh) being completely dominant over Rh negative (the absence of the self-antigen Rh). Rh positive is symbolized as + and Rh negative is symbolized as -. a. Geraldo has B- blood and Arline has O+ blood. Geraldo’s father has B+ blood and his mother has O- blood. Arline’s mother has O= blood and her father has A+ blood. Geraldo and Arline have a daughter, Elise. Using a Punnett square, what are the possible blood types for Elise? b. What is Geraldo’s genotype? c. What is Arline’s genotype?
Which of the following groups is most likely to produce anti-Fya after a transfusion of 6 units of type specific red blood cells? A. persons of Northern European descent B. persons living in the Basque region of northeastern Spain C. persons of African descent D. persons of Asian descent
Below are the ABO and Rh blood types of some couples. If during birth some blood is exchaged between the mother and the first newborn, the second newborn of which couple has the LEAST chance for suffering from hemolytic disease of the newborn due to Rh incompatibility? Consider both Rh and ABO incompatibilities. A. Wife B -, husband O + B. Wife AB -, husband AB + C. Wife AB -, husband O+ D. Wife O -, husband B + E. Wife A -, husband O+
A mother is Rh-negative and the father Rh-positive. Their baby is Rh-negative. It may be concluded that: a. The father is homozygous for D O b. The mother is heterozygous for D O. The father is heterozygous for D d. All of the above Rh typing in the question must be incorrect
An A negative mother (gravida 5, para 5) has just delivered an A positive newborn. Her antibody screen is positive and a panel shows the antibody is anti-D. The anti-D titer is 8. The child has a positive DAT. How could you determined how many doses of Rh immune globulin should be given to this mother?
Which of the following drugs is a clinically-used monoclonal antibody for the treatment of breast cancer? O a. Doxycycline O b. Chloroquine O c. Herceptin O d. Protium
In a boy of 4 the absence of VIII factor was stated in blood which leds to the prolonged bleeding when damaging vessels as a result of hemostasis violation just during the formation of: A. blood prothrombinase B. tissue prothrombinase C. thrombin D. fibrin E. thrombosthenin
Which ONE of the following markers is most commonly expressed on the surface of blast cells in B‐cell acute lymphoblastic leukaemia? Select one: A.CD20 B.CD19 C.CD3 D.CD33
When a surgeon conducts a cardiac bypass operation by transplanting a piece of vein from a patient's leg to the same patient's heart, this is a(n) a. rejected graft b. autograft c. allograft d. type IV hypersensitivity e. cardiograft
When a surgeon conducts a cardiac bypass operation by transplanting a piece of vein from a patient's leg to the same patient's heart, this is a(n) a. rejected graft b. autograft c. allograft d.type IV hypersensitivity e. cardiograft
Which of the following statements is NOT correct about the immunological incompatibility between mother and baby? Select one: a. The baby’s Rh+ blood will never get in contact with the mother’s Rh– blood during the pregnancy as the placenta does not allow fetal blood cells to mix with the maternal blood. b. When the mother has Rh– blood, anti-Rh antibody injection is given during her pregnancy to prevent any antibodies from forming. c. If the baby is Rh+ and the mother is Rh–, it does not pose a problem as long as this is the mother’s first pregnancy. d. Rh– blood has no rhesus factor proteins and therefore will produce antibodies for the Rh factor when exposed to Rh+ blood.
Which of the following individuals are carriers? (Choose ALL that apply) I-2 II-2 I-1 IV-1 II-3 III-2