Q: (ii) Is the sequence below in FASTA format? Justify your answer. >gi 129295|sp|P01013 | OVAX_CHICK…
A: Sequence alignment is a procedure in bioinformatics where DNA, RNA, and protein sequences are…
Q: What signals an mRNA for transport
A: mRNA is the specific type of messenger RNA which is single stranded . These mrna gets involve in…
Q: Use this diagram of a eukaryotic gene to answer the following questions. Pay close attention to the…
A: Introduction Gene expression is the process through which a gene's information is used to create a…
Q: Choose all the answers that apply. Where are osteoprogenitor (osteogenic) cells found?…
A: Introduction: Osteoprogenitor cells, sometimes termed to as osteogenic cells, are stem cells that…
Q: DNAT A C C A C C C C C G T A T G G C T G G G…
A: DNA and RNA acts as a genetic matter that carry the genetic information from one generation to…
Q: Cloning of an eukaryotic gene can be carried out in bacterial cells. However, for the protein…
A: Eukaryotic genes are the regions of DNA that act as templates for the production of RNA by RNA…
Q: what is the difference in the normal function of angiogenesis between children and adults?
A: .Angiogenesis: Angiogenesis is the process, in which the new blood vessels are formed from the pre…
Q: Answer these questions in a You may include labeled drawings or tables, if helpful. Short answers,…
A: Countless trillions of chemical reactions take place daily in our bodies to support vital metabolic…
Q: F. How much of a 100 mg/mL stock of Ampicillin would you need to add to 400 mL for a 100 ug/mL final…
A: Given data:- Concentration of stock of ampicillin = C1 100mg/ml. Volume of stock solution required…
Q: Considering the anatomy of reptiles and amphibians explain the difference between these two 2…
A: Reptiles and amphibians are the important organisms under the animal kingdom. They are tetrapods…
Q: 2. How would you determine if the two populations belong to the same species? What factors might…
A: Population is a group of individuals that belong to same species. Species contain organisms that…
Q: Among the following statements regarding the use of viral vectors, which is (are) true: (can be more…
A: Transfer of foreign nucleic acid insert into the eukaryotic cell is transfection. For many…
Q: Describe in detail the connection between neurotransmitters and Parkinson disease. (150 words)
A: Parkinson's disease (PD) is a neurodegenerative ailment that progresses and is characterised by…
Q: The soil bacterium Agrobacterium tumefaciens, also regarded as 'nature's own genetic engineer', is…
A: As per our guidelines, we are supposed to answer only three sub-parts. Kindly repost the question…
Q: It is often stated that excess mortality (in general) is higher in low socioeconomic populations.…
A: Socio-economic population is a population where the population is related with the society by…
Q: How does the mesophyll layer of corn differ from that of the privet (Ligustrum)?
A: The photosynthesis is responsible for production of organic molecules (carbohydrates) by using…
Q: Thymine diners A) causes a covalent bond or occur between the complimentary nucleotides B) are an…
A: Maintenance of genetic stability is not only performed by accurate DNA replication, but also via the…
Q: You are growing a culture of S. aureus. You know that 9 generations have occurred after 6 hours.…
A: Introduction Binary fission, a process that causes bacteria to divide into two daughter cells, is…
Q: ing statements about promoters that are true. A promoter specifies where RNA polymerase initiates…
A: Promoter is a specific sequence of dna, where it's length can vary from organism to organism.…
Q: The postgraduate student, Jocelyn, transformed her gene of interest into two different vectors;…
A:
Q: The principal genomic component isolated from equine influenza virus is 22% C, 23% A, 22% G and 33%…
A: Introduction Genetic material is the portion of a cell that contains the genetic information that…
Q: 2) List the names of the two major Contractile Proteins. Which of the proteins is "bound" and…
A: 2 Given that it is composed of two phospholipid layers, the plasma membrane is known as a…
Q: The arm is known as the ________ region; the neck is known as the ________ region. a. otic; axillary…
A: We can say that The human body is complex machinery that is anatomically divided into three…
Q: Macmillan Learning There are many examples of species that were ancestral to or closely related to…
A: Australopithecus afarensis existed between 3.9 to 2.9 million years ago(mya). So, the first blank…
Q: Which phase of the cardiac cycle has the largest influence on the Frank-Starling mechanism? systole…
A: Introduction : The cardiac cycle is the series of events that take place throughout each heartbeat,…
Q: Match the organelles on the figure with their functions. site of cellular respiration makes…
A: According to bartleby guidelines only the first three have been answered. Kindly post the remaining…
Q: What level do we see retinotopic organization in the visual pathways? a. Retina b. Lateral…
A: The retina contains millions of light-sensitive cells (rods and cones) and other nerve cells that…
Q: Being composed of molecules identical to certain ones already present in a host, the bacterial…
A: Bacterial capsule is usually made up of polysaccharides. Gram negative bacteria usually have capsule…
Q: 7.18 In Drosophila, the genes st (scarlet eyes), ss (spineless bris- tles), and e (ebony body) are…
A: Introduction :- any alteration to a cell's DNA sequence. Mutations may result from errors made…
Q: Agricultural runoff is a major source of pesticide and excess nutrient pollution. This is a…
A: 1) As agricultural runoff moves, gathers up, and carries away both natural and man-made pollutants,…
Q: How does the hormone glucagon affect glycogen degradation, glycolysis, and TCA cycle? Explain the…
A: Glucagon is the antagonist to insulin and increase glucose concentration in the blood.
Q: )One girl in every two has brown hair. One girl in every three has dimples. What is the probability…
A: A: Probability of 1 girl in every 2 having brown hair is 1/2.B: Probability of one girl in every…
Q: Which would be the control plate for the NaCl experiment and the Sucrose experiment and why?
A: Introduction:- control in an experiment usually set as a reference against which all other…
Q: Which is the most important digestive enzyme in gastric juice?
A: Introduction The food you eat has to be broken down by digestive enzymes. These proteins hasten the…
Q: Is it possible to perform DNA profiling with SNPs instead of SSRs as DNA markers, but in general you…
A: SNPs are used by geneticists as markers to find genes in DNA sequences. Suppose a gene alteration…
Q: Which of the following specifically explains why glucose uptake into intestinal cells happens in…
A: Active transport is selective and occurs against the concentration gradient. It is of two types…
Q: Q6.10. For a population containing 70 females and 30 males, what is the effective population size,…
A: Evolution is a steady phenomenon that cause transformation of life form from much simple to more…
Q: If radio-labeled C-2 of glucose is used for glycolysis and alcoholic fermentation, which carbon in…
A: Glycolysis It refers to the cytoplasmic pathway that converts glucose into three carbon-containing…
Q: Use the survivorship curves (A, B, and C) shown on the graph below to answer the following three…
A:
Q: How much of a 10 mg/mL lysozyme stock would you need to add to 4 mL of cells for a final…
A: The concentration (C1) of stock solution is: 10 mg/ml The concentration (C2) of working solution is:…
Q: What patterns do you detect? Often in disease outbreak investigations we want to see a pattern for a…
A: Disease outbreaks, or the appearance of more cases than anticipated, happen regularly. Health…
Q: II. Cultural characteristics of yeasts. Below is the colony diameter for each yeast culture grown on…
A: Yeasts are single-celled, eukaryotic microorganisms that belong to the fungal kingdom. There are…
Q: Genetically modified foods (GM foods) are products produced from organisms that have had genetic…
A: Crops that have had their DNA altered through genetic engineering are referred to as genetically…
Q: True or false ? Reactions in our cells happen in a perfect way, therefore DNA replication is error…
A:
Q: BasH II Kpnl Dra TTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACT…
A: Many people agree that one of the 20th century's most significant contributions to molecular biology…
Q: A shuttle vector is a vector (usually a plasmid) different host species. One of the most common…
A: Shuttle vector It refers to the type of vector, often a plasmid designed to spread among two…
Q: Word Bank 2 Acetyl-CoA 2 ATP 2 ATP 34 ATP 2-€02 4 CO₂ Electron transport chain 2 FADH₂ Fermentation…
A: Introduction A sequence of chemical processes known as cellular respiration convert glucose into…
Q: I. Growth of mold colony. Fill the table with the desired information Colony Characteristics Color…
A: Moulds include all species of the microscopic fungi that grow in the form of multicellular…
Q: A Transporter A Transporter B B Transporter C O Transporter D C D Electrochemical gradient: Which…
A: Sodium-dependent glucose cotransporters, also known as sodium-glucose linked transporters (SGLT),…
Q: You would like to clone a gene from a thermophilic bacterium isolated from a hot spring. The…
A: Designed protocol for cloning and expression 1. DNA extraction of the thermophilic bacterium using…
In muscle, glycogen phosphorylase is stimulated (activated) by
Glucose
AMP
Glucose 6-phosphate
ATP
Step by step
Solved in 3 steps
- Which molecule below is readily converted to ATP in muscle? A. glycogen B. phospho-creatine C. cAMP D. fatty-acyl carnitine E. glutamineThe synthesis and degradation of glycogen in muscle is not a futile (ATP-hydrolyzing)cycle because:A. glycogen synthase and phosphorylase are simultaneously activatedB. cyclic AMP activates adenylate kinase. C. when glycogen synthase is inactivated, phosphorylase is simultaneously activated. D. glycogen binds Mg2+, thereby lowering the concentration of MgATP2-Muscle glycogen stores would be broken down during an exercise bout lasting several hours because ________. A. exercising muscle can only utilize glucose for energy for long-term exercise B. glycogen can enter the mitochondria and produce more ATP than glucose C.exercising muscle utilizes both glucose and free fatty acids for energy during long-term exercise D. exercising muscle needs the fatty acids released from glycogen for energy
- Glucose must be activated a. The activation process produces 3 ATP. b. In the digestive system before being oxidized in the mitochondria c. In the mitochondria before being oxidized in the cytoplasm d. In the blood before being oxidized in the cytoplasmMuscle soreness and fatigue in a racehorse after a long, strenuous race is a result of in the muscle. A. anaerobic metabolism, which leads to lactic acid buildup B. aerobic metabolism, which leads to buildup of carbon dioxide C. aerobic metabolism, which leads to lactic acid deficiency D. anaerobic metabolism, which leads to ATP buildupAfter eating a large meal, which one of the following events would NOT happen? A. Increased glycolysis in liver B. Increased glycogen phosphorylase activity O C. Decreased phosphorylase kinase activity O D. Decreased GSK-3 activity E. Increased insulin levels in blood
- If glucose was no longer available, citric acid cycle activity would: a. decrease b. increase c. remain the sameAt high energy charge (ATP/AMP ratio) AND low blood glucose levels a. Pyruvate is converted to glucose via gluconeogenesis b. Glycolysis is activated c. Fatty acids are converted to Acetyl-coA d. Gluconeogenesis is inhibitedWhich of the following activate glycogen synthesis? A. Phosphorylation of glycogen synthase kinase 3 B. Activation of protein kinase A (PKA) C. Both A and B D. Neither A nor B Assuming that glucokinase is completely inhibited, which of the following statements is correct? Glycolysis reactions beyond glucose-6-phosphate in the liver would be impossible to take place The Cori cycle would be blocked Both A and B Neither A nor B
- When there is no enough CTP that binds with aspartate transcarboxylase, the mechanism that takes place is; c. Positive feedback mechanism d. Negative feedback mechanism a. Homeostasis b. GlycolysisThe immediate product of glycogen phosphorylase is: a. Glucose 6-phosphate. b. Glucose 1-phosphate. c. Fructose 1-phosphate. d. Glucose 1,6-bisphosphateDuring which of the following conversions in Glycolysis is ATP generated? (more than one answer) a. 1,3-bisphophoglycerate to 3-phosphoglycerate b. Phosphoenolpyruvate to Pyruvate c. Fructose 6-Phosphate to Fructose 1,6-bisphosphate d. Glucose to Glucose 6-phosphate