Which of the following is false? a. Methyl, phosphoryl, adenyl, uridylyl and adenosine diphosphate ribosyl groups are the modifying groups b. An example of an enzyme regulated by methylation is the methyl-donating chemo taxis protein of bacteria c. The protein is a part of the system that permits a bacterium to swim towards attractant d. The methylating agent is S- adenosylmethionine

Q: During the transcription of a given portion of a DNA molecule Select one: a. MRNA is synthesized on…

A: Messenger RNA (mRNA) is an RNA sequence that is transcripted from the DNA sequence. This mRNA is…

Q: Please choose the correct answer. Initial DNA nucleotides are added by reverse transcriptase from…

A: Reverse transcriptase is RNA dependent DNA polymerase. It transcribes ssRNA into DNA.

Q: Please answer fast List the steps of protein translation. Briefly summarize the mechanisms…

A: Genes include instructions for making proteins. They do not, though, produce proteins directly.…

Q: Please help me with the multiple choice question below - it is based on genomics/developmental…

A: The correct answer is E. Transcription factors.

Q: II. Do what is asked A. 1. a. Use the codon given below to complete the following table. Assume that…

A:

Q: Consider the following DNA sequence: CATGTGTAGTCTAAA. Address the followin questions: AWrite the…

A: In DNA,the genes are present.From these genes mRNA is formed by transcription. This mRNA undergoes…

Q: (-) A B C DEF G TE G Developmental Stage Legend: A- 1" instar D- 4 instar G- adult B- 2nd instar E-…

A: Electrophoresis is the technique to isolate various band sizes of DNA (deoxyribonucleic acid),…

Q: Please ASAP. Thank you OPTIONS a. Arg-Val-His b. Lys-Val-His c. Pro-Gly-Trp d. Met-Leu-Ser…

A: A codon is a trinucleotide arrangement of DNA/RNA that compares to a particular amino acid The…

Q: . You are provided with the DNA sequence in the leading strand template. See item number 1 in…

A: DNA is a molecule that carries the genetic information for the individual.

Q: Matching type: Choose the effect of the given agents to translation or transcription  Choices: RNA…

A: Transcription and translation are the processes by which a gene can express itself in the form of…

Q: A Staphylococcus aureus undergoes a lac operon mutation that prevents repression of structural genes…

A: Lac operon - Lac operon or lactose operon is the DNA segment that controls the metabolism of lactose…

Q: How does the Cas9 endonuclease bind to specific sequences of DNA in order to make cuts?   A.  It…

A: Cas9 is a 160-kilodalton protein that plays a key part in certain bacteria's immunological defence…

Q: . Which of the following is true about DNA or RNA nucleotides? A. RNA has a ribose, thymine, and is…

A: *A polymer made of two polynucleotide chains that coil around one another to form a double helix is…

Q: Question 18 4) Listen The transcription complex includes a localed on the DNA, that assist to find…

A: Transcription is the process by which cell makes an RNA copy of a piece of DNA.  mRNA carries…

Q: 1. Analyze the following and identify which one mentions the function of a common eukaryotic ligase?…

A: Enzymes are protein-based biomolecules. They accelerate chemical reactions. They participate in a…

Q: 7. Human proteins can be produced in a variety of organisms. What would be advantages of producing…

A: Biotechnology can be defined as the practice of using living organisms such as animals, plants,…

Q: 1. Analyze the following and identify which one mentions the function of a common eukaryotic ligase?…

A: Ligase enzymes are enzymes of Enzyme classification class 6 and it catalyzes the formation of C-C,…

Q: How has the mutation altered the polypeptide? Is the function of the hemoglobin molecule (which…

A: Sickle cell disease is a blood disorder characterized by sickle shaped RBCs which has got less…

Q: Find the mismatched pair regarding broad spectrum antibiotics A. Chloramphenicol-prevents protein…

A: Antibiotic is a anti-microbial substance that work against bacteria. Antibiotics may either kill or…

Q: Answer the ff. DNA fragment A is 3' AGC CCG CTC CGA GGC TAA AAG CGT 5' A. is the 3rd amino…

A: Transcription: The process of making mRNA from DNA is called Transcription. mRNA strand Synthesised…

Q: 1. What is called the functional unit of a DNA molecule that may code for RNA or protein? A. arnino…

A: DNA or deoxyribonucleic acid is the molecule that is made up of polynucleotide chains coiled around…

Q: Our DNA sequence: 5' - CGCTTATAATCGTTACGACGGCAATTA CGGGATTCCTCGCGAAA - 3'. What is the RNA…

A: The nucleic acids are DNA and RNA. Nucleotides, which have a five-carbon sugar backbone, a phosphate…

Q: Please answer fast Explain how you would go about developing new ribozymes capable of targeting new…

A: Ribozymes are the ones that arefound to be catalytically active RNA molecules. Here, RNA is…

Q: What time of mutation is exhibited when a codon AAT is replaced with GGC?     a. Insertion     b.…

A: 1) Option C that is Substitution is the correct answer because in substitution, replacement of one…

Q: 17. Lariat formation is a step in which of the following: transcription post-translation…

A: Lariat formation is a step in transcription.

Q: 21. Which of the following mutations would be expected to have the most harmful effect on the…

A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Please choose the correct answer. Given the sense strand of DNA, A T G T A A C C G C G C A A G G G C…

A: Transcription is the process in which RNA is made from DNA. Translation is the process of making…

Q: PLEASE ANSWER THE QUESTIONS 1. Why is it important to have knowledge of the correct method of…

A: Asked : Importance of knowledge of translation and situations in which it is necessary

Q: Explain why a defi ciency of the vitamin folic acid could lead to undermethylation of histones and…

A: DNA methylation is a commonly used mechanism for epigenetic gene regulation. S-adenosylmethionine…

Q: TRUE OR FALSE 1. A mutation is considered induced when a bacterial cell is exposed to harsh…

A: All the given statements are true.

Q: Shown below is a nucleotide sequence alignment consisting of corresponding sequences of the same…

A: A change in the normal specific DNA sequence that can arise due to the anomaly is DNA replication or…

Q: Chain termination/Nonsense mutation - no a.a. that corresponds to a new base sequence; results to…

A: Introduction:- Mutations are defined as any kind of heritable change occuring in the genetic…

Q: Which of the following functions describes the enzyme Peptidase? A. remove phosphate from a…

A: Peptidase are enzymes that comes under the category of hydrolase that is class 3 of enzymes i.e.,…

Q: Viruses that infect bacteria (bacteriophage) sometimes encode a lysozyme gene in their genome. The…

A: Bacteriophage is one type of virus which infects bacterial cell and destroy it. Bacteriophage…

Q: 5. In class we described two post-translational modifications which could be used to control…

A: The enzymes are the proteins. They are coded by the gene sequences present in the DNA. These gene…

Q: DUE IN 30 MINUTES. This is multiple choice. No need for explanation, answer only. Thank you! A…

A: Basic amino groups (-NH2) and carboxyl groups (-COOH) are found in amino acids. Proteins have amino…

Q: C. Two mutations are known in the population, one shaded in yellow and one in blue, in the TEMPLATE…

A: Mutations are changes in the sequence of DNA that arise due to a change of nucleotides, which can be…

Q: What item/s are true? 1. When the 3' -ATCGGCTAC-5' IS TRANSLATED THE COMPLEMENTARY STRAND…

A: DNA and RNA are important for cell function as DNA provide the information for the cell's…

Q: Fill in the blanks.  In this schematic, [] represents a gene (DNA) that is transcribed and processed…

A: Transcription is a significant process that occurs in a cell through which the RNA is synthesized…

Q: likely be able to bind a Cyclic AMP DNA binding protein? (only one strand is shown but assume DNA is…

A: CRP is a transcription factor that, when complexed with cAMP, binds DNA and activates transcription…

Q: 1. Determine the ph of a 0.30 M NaH2PO4 and 0.20 M H3PO4 solution. pka is 2.16. А. 1.3 В. 2.3 С. 3.3…

A: 1. 2.3 When the moles of base added equals half the total moles of acid, the weak acid and its…

Q: 1 IN PROKARYOTES INVOLVES MODIFIED BY 3 2 INVOLVES 5 IN EURARYOTES MAY INVOLVE 4 REGULATION OF GENE…

A: The process through which the instructions in our DNA are transformed into a functioning product,…

Q: State whether TRUE or FALSE. Explain your answer   Reverse transcription occurs naturally in the…

A: Reverse transcription is mainly an event in which RNA is converted into c-DNA.This is mainly done by…

Q: If you grow Trp R E.coli cells in a medium containing tryptophan, which of the following stem-…

A: The tryptophan binds to the trp repressor and causes it to change shape, converting into its active…

Q: microRNA DICER RISC [Se PABP Se

A: Post transcriptional gene regulation:The process of controlling of gene expression which occurs…

Q: A. Consider the following DNA sequence (coding strand) located near the middle of the coding region…

A: Answer option  ll will result in shorter strand

Q: 4) RNAI is the name used to describe a system that cells use to shut down the translation of…

A: ANSWER;- RNAi is mainly of two types: small interfering RNA(siRNA)- which are made artificially or…