Which of the following is false? a. Methyl, phosphoryl, adenyl, uridylyl and adenosine diphosphate ribosyl groups are the modifying groups b. An example of an enzyme regulated by methylation is the methyl-donating chemo taxis protein of bacteria c. The protein is a part of the system that permits a bacterium to swim towards attractant d. The methylating agent is S- adenosylmethionine

Q: 8. A type of gene therapy called RNA interference (RNAI) is being investigated to treat Huntington's…

A: During transcription, the DNA double helix unwinds and the RNA polymerase enzyme reads the template…

Q: what reaction activates the amino acids for attachment to the appropriate tRNA before being…

A: Translation is the process of synthesis of proteins from mRNA. It is completed in three steps -…

Q: (-) A B C DEF G TE G Developmental Stage Legend: A- 1" instar D- 4 instar G- adult B- 2nd instar E-…

A: Electrophoresis is the technique to isolate various band sizes of DNA (deoxyribonucleic acid),…

Q: Since there are 61 sense codons (excluding stop codons), most cells contain 61 different types of…

A: A codon that codes for an amino acid is called the sense codon and there is three nonsense stop…

Q: Please ASAP. Thank you OPTIONS a. Arg-Val-His b. Lys-Val-His c. Pro-Gly-Trp d. Met-Leu-Ser…

A: A codon is a trinucleotide arrangement of DNA/RNA that compares to a particular amino acid The…

Q: | | || | || a. Label each lane of the gel. Write only the corresponding letters in the wells above.…

A: Introduction Gel electrophoresis is a laboratory technique for separating DNA, RNA, and protein…

Q: 16. Eukaryotic initiation factor elF2B is a guanine nucleotide exchange factor. Explain why elIF2B…

A: The eukaryotic initiation factor elF2B is the guanine nucleotide exchange factor, which converts…

Q: Polypeptide sequences are formed from 20 amino acids. What is the probability that a single point…

A: When a point mutation occurs, one of three things may happen:Due to the mutation occurring in a…

Q: The following sequence has been mutated as follows. What type of mutation is this? Original DNA: 3'…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: deu suoi op MOH

A: Q  1.  DNA is the main genetic material, it is made up of polynucleotide. Mutation can be defined as…

Q: 19. Endorphins are polypeptides that reduce pain. What is the amino acid order for the following…

A: The body produces endorphins, which are neurotransmitters that can provide sensations of pleasure or…

Q: 12b. Fill in the following table about the Lac operon (LacZ gene) Environmental Condition + Glucose…

A: Gene regulation is the mechanism to control the amount of gene expression in the cells.

Q: 9. Examine the image to the right, which represents a snapshot of translation. Which staan of…

A: Translation is the process of making proteins from RNA. Transcription is the process of making RNA…

Q: 7. Fill in the following table. Acid TRNA MRNAI DNA DNA amino sense anti-sense UGA UGA, Histidine…

A: Transcription: It is the process through which the enzyme RNA Polymerase transfers information from…

Q: DNA sense or template DNA sense or template mRNA tRNA protein 5', 3' amino or carboxyl 5' T U A A RG…

A: The genetic information for protein synthesis is stored in DNA. DNA is double-stranded. The…

Q: Explain the genetic advantage for the codon 5'-AAG-3' to code lysine and the codon 5'-AGG-3' to code…

A: Introduction Any of the 64 distinct DNA sequences of three consecutive nucleotides that either…

Q: Write TRUE or FALSE. If false, write the word/s that make(s) the statement incorrect. A glycosidic…

A: Similar to Deoxyribose Nucleic Acid(DNA), RNA(Ribose Nucleic Acid) is a linear polymer composed of…

Q: Figure out the mutation. You will need the codon table to answer this question. Wild type DNA…

A: DNA is two strand ladder like structure which consists of :-  A ) Coding strand  B ) Template strand…

Q: 7. Human proteins can be produced in a variety of organisms. What would be advantages of producing…

A: Biotechnology can be defined as the practice of using living organisms such as animals, plants,…

Q: 2. Use the MRNA sequence to find the DNA sequence and the amino acid sequence. DNA MRNA-…

A: Nucleic acids are present inside the nucleus to store and pass genetic information and thus control…

Q: 3' -T ACATC T T G G C GAC GAC T-5' Mutated DNA Sequence #1: MRNA sequence? (Circle the change) Amino…

A: 1)DNA - 3'- TAC ACC TTG GCG ACG ACT-5' mRNA - 3'- AUG UAG AAC CGC TGC UGA-5' Amino acid sequence –…

Q: 7 Which of the following is the correct polypeptide chain for the mRNA strand shown below?…

A: A codon is a group of three nucleotides in an mRNA grouped to code for a particular amino acid. The…

Q: 3. Which of the following is false? a) Methyl, phosphoryl, adenyl, uridylyl and adenosine…

A: Enzymes are basically proteins that are intricately packed within with the help of intramolecular…

Q: Find the mismatched pair regarding broad spectrum antibiotics A. Chloramphenicol-prevents protein…

A: Antibiotic is a anti-microbial substance that work against bacteria. Antibiotics may either kill or…

Q: Answer the ff. DNA fragment A is 3' AGC CCG CTC CGA GGC TAA AAG CGT 5' A. is the 3rd amino…

A: Transcription: The process of making mRNA from DNA is called Transcription. mRNA strand Synthesised…

Q: Our DNA sequence: 5' - CGCTTATAATCGTTACGACGGCAATTA CGGGATTCCTCGCGAAA - 3'. What is the RNA…

A: The nucleic acids are DNA and RNA. Nucleotides, which have a five-carbon sugar backbone, a phosphate…

Q: Please help me with this question. More than one answer may be correct. THe graph relating to the…

A: The graphical representation illustrates the percentage of cells exhibiting clusters of IRE1…

Q: 21. Which of the following mutations would be expected to have the most harmful effect on the…

A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Yhich amino acid is considered to be hydrophilic? a. Methionine b. Alanine c. Glycine d. Threonine

A: Hydrophilic amino acids are those acids which are highly stable when present in water. They are…

Q: 5. There is more than one codon and tRNA for most amino acids. The L-shaped molecule binds a…

A: Charged tRNA match an mRNA codon with the amino acid it codes. tRNA brings amino acids to…

Q: Choose the correct option for following three mcqs 10.Which of the following statements regarding…

A: The genes are the hereditary unit of an organism which are passed on from the parental generation to…

Q: A new virus variant has a protein with the following amino acid substitutions: S25K, L72F, T931,…

A: Amino acids are the molecules of carbon, hydrogen, nitrogen and oxygen that contain one carboxylic…

Q: 7 Which of the following is the correct polypeptide chain for the mRNA strand shown below?…

A: The polypeptide is formed by the process of the translation process, where mRNA carries codons…

Q: Why is there some signal present within the ‘no sugar’ and other noninducing sugars for the green…

A: The arabinose promoter is a special type of DNA sequence that controls the expression of genes in…

Q: Matching type Choices are in the picture 1. Puromycin 2. Amanitin 3. Tetracycline 4. Rifampicin…

A: DNA acts as the genetic material in most organisms. DNA is first transcribed into mRNA with the help…

Q: Chain termination/Nonsense mutation - no a.a. that corresponds to a new base sequence; results to…

A: Introduction:- Mutations are defined as any kind of heritable change occuring in the genetic…

Q: 5. In class we described two post-translational modifications which could be used to control…

A: The enzymes are the proteins. They are coded by the gene sequences present in the DNA. These gene…

Q: What item/s are true? 1. When the 3' -ATCGGCTAC-5' IS TRANSLATED THE COMPLEMENTARY STRAND…

A: DNA and RNA are important for cell function as DNA provide the information for the cell's…

Q: The following is the DNA sequence of the entire protein-coding region for some small gene in a…

A: Mutations in the DNA molecule are caused by a spontaneous alteration. After a synonym mutation, the…

Q: 16. Which of the following describes what happens to the codons of a cell that is affected by sickle…

A: Sickle cell anemia is a genetic disorder that affects the hemoglobin protein in red blood cells. It…

Q: 1. Determine the ph of a 0.30 M NaH2PO4 and 0.20 M H3PO4 solution. pka is 2.16. А. 1.3 В. 2.3 С. 3.3…

A: 1. 2.3 When the moles of base added equals half the total moles of acid, the weak acid and its…

Q: 1 IN PROKARYOTES INVOLVES MODIFIED BY 3 2 INVOLVES 5 IN EURARYOTES MAY INVOLVE 4 REGULATION OF GENE…

A: The process through which the instructions in our DNA are transformed into a functioning product,…

Q: If you grow Trp R E.coli cells in a medium containing tryptophan, which of the following stem-…

A: The tryptophan binds to the trp repressor and causes it to change shape, converting into its active…

Q: Part Three. Suppose you are a lab technician who is responsible for diagnostic analysis of…

A: A protein involved in a critical biological activity, such as DNA repair or cell division, that is…

Q: b. Which of the following statements is not true? O Microarrays are used to determine gene…

A: The processes that regulate how genes are expressed in cells are referred to as gene regulation. It…

Q: 7. Using the diagram on the left, the molecule coded directly from DNA is represented by what…

A: Instead, the DNA is used to create a messenger RNA (mRNA) molecule, which then controls the…