What is the name of the nucleotide sequence that helps the 30S ribosomal (small) subunit find the initiation codon on bacterial MRNAS? Shine-Dalgarno Sequence. CTD Sequence. TATA box. Watson-Crick Sequence.

Q: How many different mRNA sequences can encode a polypeptide chain with the amino acid sequence…

A: Polypeptide chain includes a sequence of amino acids that are coded by different codons during the…

Q: If a scientist synthesizes a DNA molecule with a nucleotide base sequence to TACGGGGGAGGGGGAGGGGGA…

A: There are 4 nitrogen bases present in DNA, these are Adenine, Thymine, Cytosine, and Guanine.…

Q: In which of the following would you find the start codon sequence of a gene? mRNA DNA and…

A: Codons are made up of three consecutive nucleotides. The sequence of start codon is AUG. It…

Q: RNA polymerase starts synthesizing RNA at the _______     start codon     TSS     first exon

A: To start deciphering a gene, RNA polymerase ties to the DNA of the quality at a district called the…

Q: Explain the process translation. A complete answer will include the words below tRNA, amino acid,…

A: The translation is the process of amino acid change of protein synthesis from the mRNA sequence. The…

Q: Which of the following types of mutations, resulting in a change in the mRNA just after the…

A: The translation process will result in the creation of proteins. The process of protein synthesis is…

Q: Portions of eukaryotic mRNA sequence that are removed during RNA processing are ________. a. exons…

A: The genetic material of a cell or an organism refers to those materials found in the nucleus,…

Q: mRNA and tRNA are involved in producing proteins from genes in the DNA. One codon consisting of 3…

A: Nucleic acids are involved in various processes in the cell, their main role is the expression of…

Q: During translation, a peptide is PRODUCED , while the MRNA is READ N-->C, 3-->5' 5'-->3'; N-->C.…

A: ANSWER;- N'-- C; 5'--3';

Q: Bacteria Eukaryotes First amino acid 5' end 3' end Cistron Introns/exons

A: Bacterial and eukaryotic m-RNA is different from each other in bacterial translation first amino…

Q: In this sequence there are two introns and three exons. Exon 1 has 3 amino acids, exon 2 has 4 amino…

A: Once a gene is transcribed into a pre-mRNA transcript containing both coding (called as exons)…

Q: mRNA binds to a ribosome. Transcription completes. mRNA leaves the nucleus. tRNA attaches to the…

A: DNA translation is the term used to portray the course of protein synthesis by ribosomes in the…

Q: A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the…

A: BASIC INFORMATION  TRANSLATION  It is the process in which protein is which formed from the…

Q: How many amino acids are coded for by one codon? O a) 1 O b) 2 O c) 3 O d) 4

A: The sequence of three nucleotides of DNA and RNA is known as Codon. There are 64 different codons…

Q: The "TATA box" is a [DNA, RNA, Carbohydrate, protein]  sequence known as a [promoter, start codon,…

A: We all know that the central dogma of molecular biology explains that DNA codes for RNA, which codes…

Q: Which of the following statements about the genetic code are true and which are false? Correct each…

A: Genetic code is the sequence of nucleotides in the mRNA that determines the sequence of amino acids.…

Q: Which sequences are spliced out of the mRNA strand before leaving the nucleus?  In other words,…

A: Answer: TRANSCRIPTION : It is the process in central dogma where a DNA strand is transcribed in to…

Q: The genetic code uses three bases to encode one amino acid. Why can't the code use only two bases to…

A: Genetic code is a triplet code that consist a set of three nucleotide bases, known as codons. Each…

Q: The template strand of a gene has the sequence 5' CTAGTTGGCACACTCCATGGT 3'. Starting from the start…

A: The nucleic acids DNA and RNA are found in all living things. The deoxyribose nucleic acid is DNA,…

Q: Which of the following is located at the C-terminus of a newly synthesized eukaryotic proteins?…

A: Initiation of translation occurs when the small ribosomal subunit binds with initiation factors and…

Q: Define and identify the words listed below: CRISPR, codon, anti-codon, transcription

A: Definition:  CRISPR:                  A segment of DNA compiled of short repetitions of base…

Q: A scientist sequencing mRNA identifies the following strand:…

A: mRNA is termed as messenger RNA. It is a single stranded RNA used in the synthesis of protein.mRNA…

Q: Look carefully at the illustrations for gene translation. What mRNA codon specifies the tRNA…

A: As the illustration for the gene translation is not given. we are providing all the possible codons.

Q: The reading frame of a protein is determined by the first nucleotides in the mature mRNA sequence.…

A: The translation process is the protein synthesis process within a cell. mRNA coding is translated…

Q: Give two examples of places you could have mutations in the DNA sequence of a eukaryotic gene that…

A: The change in the heritable characteristics of the species across many generations is called…

Q: The first column of the table below shows the beginning of a gene and five different mutations of…

A: Codon is a sequence of three nucleotides that codes for specific amino acid. Codons encode amino…

Q: If a scientist wants to target a DNA sequence in a gene that reads TAC CCG GGC TTA, what should the…

A: * DNA is composed of nucleotide bases . Four nucleotide bases are present  Adenine Guanine Thymine…

Q: What is the sequence of bases in the template strand of DNA that codes for the mRNA in Problem?

A: The sequence of mRNA given in the problem is 5'AAA GUU GGC UAC CCC GGA AUG GUG GUC 3' and the…

Q: result

A: Transition mutation is nothing but the replacement of one purine nucleotide with other and one…

Q: In which of the following does nitrogenous base pairing (base complementarity via hydrogen bonds)…

A: Nitrogenous base pairing can include DNA-DNA, DNA-RNA, RNA-RNA pairing. Both DNA and RNA are made up…

Q: RNA are involved in producing proteins from genes in the DNA. One codon consisting of 3 nucleotides…

A: Deoxyribonucleic acid (DNA) comprises the genetic information or the instructions required by an…

Q: A particular triplet of bases in the coding sequence of DNA is AAA. The anticodon on the tRNA that…

A: If the template strand of DNA has AAA, it will be transcribed to mRNA as UUU. A tRNA that would…

Q: If the following changes occurred in the gene, identify the type of mutation and how it would affect…

A: Codon is a triple of nucleotide base pair. Any change in the sequence resulting in altered phenotype…

Q: A scientist while sequencing mrna identifies the following strand…

A: Translation is the process by which polypeptides are synthesized from a mRNA transcript which is…

Q: A gene is a piece of DNA that codes for a protein.  Genes are transcribed into mRNA and are on the…

A: Sometimes mutation disrupts protein synthesis by substitution, deletion, or insertion of one or more…

Q: A Section of a Gene TGC GTG TAC CTA CCA For the DNA sequence shown above, identify the following:…

A: The given DNA sequence is as follows,  TGC GTG TAC CTA CCA

Q: What is the sequence of the MRNA codon that binds to the anticodon 3'-AAG-5'? 5'-AAG-3' 5'-TTC-3'…

A: Anticodon:  A trinucleotide sequence that is complementary to a matching codon in a messenger RNA…

Q: When given the DNA message sequence, 5'-ACT-3', what would be the corresponding DNA template strand…

A: In biology, a DNA strand is the double-stranded molecule of nucleic acid that serves as the…

Q: Each one gives some basic information and summarizes its main role in translation.   rRNA:…

A: The synthesis of protein or polypeptide chain from the mRNA sequence (that contain genetic codon) is…

Q: Use the three letter code for amino acids. If they stop codon is encountered use the word stop…

A: A change in the DNA sequence is known as a mutation.

Q: If the DNA has a triplet code of CAG in one strand (the strand used as a template for transcription)…

A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: The exon and intron sequences

A: The correct option is: 1. The exon and intron sequences

Q: help

A: Translation is the process for synthesizing the protein from mRNA by the action of ribosomes. It…

Q: Which statement is correct? OA cap is removed from the 5' end of a DNA molecule A сар A poly-A tail…

A: The biochemical substance that is carried from the preceding generations to the succeeding…

Q: Which of the following provide clues that a particular DNA sequence is part of protein-coding gene?…

A: A protein-coding gene is a DNA sequence that instructs the cell to create a specific protein.…

Q: If the following were part of a DNA chain, what mRNA bases would pair with it to transcribe the DNA…

A: INTRODUCTION The carrier of genetic information within a cell is DNA, which stands for…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: DNA consists of two intertwined polynucleotide strands: coding strand and template strand. The…

Q: Is there a difference between a DNA library and a CDNA library? No, the DNA library contains all the…

A: DNA sequence contains noncoding regions, regulatory regions other than coding regions. These regions…

Q: Through wobble, a single ____________________ can pair with more than one ____________________. a.…

A: Through wobble, a single anticodon can pair with more than one codon.

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.