what experiment can be used to confirm that agglutination was due to the binding of the lectins to sialic acid.
Q: The structure shown is an example of a type of macromolecule (carbohydrate, lipid, protein, or…
A: The biological macromolecules that constitute a cell are proteins, nucleic acids, lipids and…
Q: What compound of phosphorus is found in nucleic acids? What are the products of hydrolysis in RNA…
A: DISCLAIMER FOR MULTIPLE Since you have asked multiple question, we will solve the first question…
Q: 1. Enzymes A) tilt the reaction equilibrium in favor of product formation B) tilt the reaction…
A: The enzymes are biological catalysts that increases the rate of biochemical reactions. Most enzymes…
Q: Below is a fractional saturation curve for O2 binding to adult hemoglobin. Assume that curve Y…
A: Fractional saturation curve of Haemoglobin for oxygen binding describes the amount of oxygen that is…
Q: Give the corresponding class, subclass, sub-subclass, specific enzyme of the following E.C. codes.…
A: Enzymes are proteins which serve as catalyst for a biochemical reactions. It doesn’t get involved in…
Q: The AG of the reaction C6H12O6 +602 --> 6CO2 + 6H₂O is -686 kcal/mol glucose The oxidation of…
A: For biological systems, free energy (G), enthalpy (H) and entropy (S) are related as : ∆G = ∆H - T∆S…
Q: The main stages of catabolism of biomolecules: proteins, carbohydrates and lipids.
A: Catabolism is the degradative pathway. It deals with the breakdown of complex molecules into simpler…
Q: When disaccharides are heated in the presence of a strong acid, the linkage joining the two…
A: There are four types of biological macromolecules, nucleic acids, proteins, carbohydrates and…
Q: [Select] 1. Using hydrophobic interaction chromatography, the protein that will be eluted last is 2.…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: 1x GGCGAUGGGCAAUAAACCGGGCCAGUAAGC Identify the start codon, and determine the complete amino acid…
A: Translation is the process of synthesis of proteins from mRNA. Proteins are synthesized by adding…
Q: Which of the following amino acids is generally absent from an a-helix? tryptophan serine isoleucine…
A: The alpha helix is secondary structure of protein in which the amino acid chain is arranged in a…
Q: ● What are the three things we need to know in order to begin to understand the way an active site…
A: Enzymes are high molecular weight proteins that catalyse biochemical reactions. The substrate binds…
Q: 2. The two diagrams to the right il- lustrate plots of steady-state ki- netic studies to…
A: Phosphofructokinase-1 (PFK-1) is a rate limiting enzyme of the glycolytic pathway. PFK-1 catalyzes…
Q: Draw the following Lipids in: A) Condensed (detailed) Structure, B) its Block Diagram. C)…
A: A sphingosine , stearic acid and D-galactose would condense to form a sphingolipid. Sphingolipids…
Q: receptor/s b. the energy source c. if there is signal peptide cleavage or none E. Mitochondrion…
A: Major proportion of the mitochondrial proteins are encoded by the nuclear genes. These proteins are…
Q: Which of the following is zwitterion structure of the amino acid alanine? O NH3 NH3 O NH₂ O OH O no…
A: Amino acids are biomolecules that have an amino group (-NH2), a carboxyl group (-COOH) and a side…
Q: Submit a drawing of the following phospholipid: -x-group is phosphoserine (use google if you need…
A: Glycerophospholipids or phospholipids are lipids found in the biological membrane. In phospholipids,…
Q: 1. Which types of RNA are transcribed by each RNA polymerase enzyme in eukaryotic cells?
A: Transcription is the synthesis of RNA from DNA that is the process of copying the information of a…
Q: Select the chemical consequences that could contribute to DNA instability at AP sites. fewer…
A: AP sites are apuraniya sites that are created through the hydrolysis of N glycosyl bond between…
Q: What mechanism of RNA regulation is responsible for the two different forms of apolipoprotein B? O…
A: Apolipoprotein B is encoded in humans by APOB gene. It is the primary apolipoprotein of VLDL, LDL…
Q: List the possible interactions in proteins that would affect ∆G.
A: The proteins must fold into its proper three dimensional structure in order to gain biological…
Q: General ways of metabolism; catabolic, anabolic and amphibolic reactions.
A: The total number of biochemical processes that keep a biological organism's cells functioning…
Q: Fumerase is an enzyme in the citric acid cycle that catalyzes the conversion of fumerate to…
A: Parameters such as Km and Vmax are used for comparing enzyme activities. If we know the initial rate…
Q: Which of the following is NOT true of a competitive inhibitor? A) Its effects can be overcome by…
A: Competitive inhibitor- It competes with the substrate for the active site of an enzyme, while the…
Q: If your body sense that is very low on the substrates necessary to produce ATP homeostatic control…
A: Deamination of amino acids - it is the process of breakdown of amino acids which occurs in excess…
Q: Which of the following shows the structure of aspartic acid at pH 11? a H₂N. ОН ОН b H₂N ОН с H₂N ОН…
A: Aspartic acid (Asp or D); ionic form is known as aspartate, is an α-amino acid that is used for the…
Q: Does the presence of an uncompetitive inhibitor increase / decrease the apparent affinity of the…
A: Uncompetitive inhibition occurs when an inhibitor binds to an allosteric site of a enzyme, but only…
Q: Proteins form plant sources are Always complete dietary protein Seldom complete dietary protein It…
A: Proteins are substantial, intricate molecules that are essential to numerous bodily processes. They…
Q: Flippases help maintain membrane asymmetry. True False
A: Introduction Plasma membrane is he outer membrane of animal cell. Plasma membrane is composed of…
Q: Carbohydrates and proteins each generate 4kcal/g when oxidized in the bomb calorimeter but in…
A: Cellular respiration Cellular respiration is a collection of three metabolic pathways that generate…
Q: OH i ACP Suppose that a "snapshot" of FA synthase was taken and the above (drawn) intermediate…
A: The given reaction is from fatty acid biosynthesis that occurs in the cytoplasm. Fatty acid…
Q: Calculate the resulting equilibrium concentrations of all four species. Express your answers to four…
A: In a general reaction such as: aA + bB ⇌ cC + dD At equilibrium, the concentration of reactants and…
Q: what telomerase does and why it's necessary?
A: Introduction In the nucleus the DNA molecule is packaged into thread-like structures called…
Q: What is the isoelectric point of the peptide LIKES? Show your work below.
A: This peptide is composed of leucine, isoleucine, lysine, glutamic acid, and serine. This peptide…
Q: Which of the following enzymes is NOT used when fructose is metabolized to pyruvate in the liver? a.…
A: Glycolysis is the collection of 10 enzymatically catalysed reactions that sequentially oxidises a 1…
Q: What are the pH buffering regions (pH range) of Glutamyl-histidyl-lysyl-arginine? Click all that…
A: The proteins are composed of 20 naturally occurring amino acids. The net charge on a protein or…
Q: Which coenzyme is NOT paired with its correct dietary precursor? thiamine → thiamine pyrophosphate…
A: Coenzymes are important in the metabolic pathways as they help enzymes in catalysing the reactions.…
Q: You start with 100 units of protein activity and 100 grams of total protein. After the first…
A: Protein purification is performed to purify a target protein from a mixture of proteins. Fold…
Q: Which technique would best seperate a protein that binds stongly to its substrate?
A: Chromatography is a technique that is used for separation of biological macromolecules form a…
Q: Compare the principle behind DNA migration in an agarose gel electrophoresis from that of protein…
A: Electrophoresis means the migration of a charged particle under the influence of an applied electric…
Q: 13. How would ATP production in an aerobic yeast culture change if we add the following metabolites…
A: Aerobic yeast culture is a metabolic process in which glucose is metabolize by fermentation even in…
Q: The biexponential equation for a two compartment model drug is C1,t = 50.0e-1.64t + 20.0e-0.147t.…
A: Pharmacokinetics: The study of the kinetics of drugs absorption, distribution, and elimination…
Q: KINETIC CONSTANT No Na2HPO4 25mM Na2HPO4 50mM Na2HPO4 Vmax nmol p-NP. Min- 20.3252 14.30615 17.30104…
A: Active site is the site where a substrate molecule binds with an enzyme. The binding between a…
Q: A mutation produces a tRNA with a new anticodon. Originally the anticodon was 5'-CCA-3'; the mutant…
A: Sometimes a codon that coded for some amino acid in a mRNA gets mutated to a stop codon. This type…
Q: 1. Oxidative phosphorylation and synthesis of ATP in mitochondria: • ways of ATP formation in cells…
A: Since you have asked multiple questions with multiple sub-parts, we will solve the first three…
Q: Q6.1: Three critical features of enzyme structure and function contribute to the overall efficiency…
A: The enzymes are biological catalysts that increases the rate of biochemical reactions. The enzymes…
Q: Riboflavin is an important nutrient required for a number of biochemical processes that produce…
A: Riboflavin is commonly known as vitamin B2. Riboflavin is a type of Vitamin B. It is soluble in…
Q: Use the table below to answer the question being asked: Protein Ovalbumin Insulin Fibrinogen…
A: Sodium Do-decylSulphate PolyAcrylamide Gel Electrophoresis (SDS PAGE) is a method used to separate…
Q: 1. Which of the following pathways of information flow has never been observed on Earth? chose all…
A: Note: Hi! Thank you for the question. We are authorized to answer one question at a time. Since you…
Q: Under aerobic conditions of high ratios of NADH/NAD+ and ATP/ADP, as pyruvate is utilized for its…
A: Glycolysis: The process through which glucose is broken down to create pyruvate in a cell's…
what experiment can be used to confirm that agglutination was due to the binding of the lectins to sialic acid.
![](/static/compass_v2/shared-icons/check-mark.png)
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- How does one experimentally confirm agglutination is due to the binding of the lectins to sialic acid.Design a simple experiment to confirm that agglutination was due to thebinding of the lectins to sialic acid.The production of arginine is terminated by the presence of excess arginine. State which phenomenon is responsible for this outcome. Explain the phenomenon in brief.
- Which statement best describes the principle behind the succinate dehydrogenase (SDH) assay used in the assay of subcellular fractions from mung bean seedlings? Question 11 options: SDH oxidized succinate to fumarate, then fumarate reduced DCPIP. Succinate is blue in colour, which is eliminated by its oxidation to fumarate by SDH. SDH produced FADH2, then FADH2 reduced DCPIP. SDH generated DCPIP, then DCPIP oxidized succinate to fumarate.Which patch clamp technique should be used if you want to investigate the effect a compound has presynaptically with varying concentration?The protein fragments ABS1 and ABS2 of tropomodulin were produced as fusion proteins with chitin binding domain and purified by a chitin column. Explain the principles of this type of affinity chromatography and support it with a self‐drawn figure. This is with regards to Tropomodulin/ F-Actin complex.
- How might the technique of affinity chromatography be used to purify lectins ?Mucolipidosis type X is a lysosomal storage disease that was suggested to be a result of impaired mannose 6-phosphate receptor function. How would you test that? I need an example of a quantitative assay.How does the loss of the Adenomatous polyposis coli (APC) protein lead to the deregulation of Beta-catenin functions in FAP patients?
- Explain the signifi cance of the observation that peptides such as fMet-Leu-Phe “activate” the phagocytotic (particle-engulfi ng) functions of mammalian leukocytes (white blood cells).You are studying the uptake of L-leucine by epithelial cells of the mouse intestine. Measurements of the rates of uptake of L-leucine and severalof its analogs, with and without Na+ in the assay buffer, yield the results given in the table below. What can you conclude about the properties and mechanism of the leucine transporter? Would you expect L-leucine uptake to be inhibited by ouabain?Which letter represents the target site of furosemide (Lasix)? E- -B