This activity breaks down protein synthesis using the metaphor of PIZZA! Use your Amino Acids Reference Sheet to complete the following table. Fill in the blank spaces of each row with either the missing DNA triplet, the mRNA codon, or the Amino Acid. While there are actually multiple codons that code for any one amino acid, for this activity there only needs to be one DNA triplet and one corresponding mRNA codon recorded for each amino acid. Remember: RNA uses uracil (U) instead of thymine (T)! TTG GGG CGT AAA TTT CAA DNA AAC UAU CAC GCA AAA mRNA codon Asparagine Proline Amino Acid Tyrosine Histidine

Q: The drug, erythropoietin (EPO) is an artificial version of a protein that is naturally produced by…

A: DNA is the double-stranded molecule that is the genetic material in most animals except for some…

Q: Pissssssssss helppppppppp, One strand of DNA reads T-A-C-G-A-G-C-T-C. Describe the steps of protein…

A: Transcription is the process by which RNA is produced from the DNA template in the nucleus of…

Q: Aminoacyl-tRNA synthetase joins amino acids to their cognate trna. Briefly discuss the two reactions…

A: Aminoacylation is mechanism of attachment of amino acid to tRNA. Aminoacyl-tRNA synthetase joins…

Q: Glycosylation is a major type of protein post-translational modification. Identify the amino acid…

A: Cavalent or generally enzymatic reactions takr place after or during translation are termed as post…

Q: The genetic code was deciphered by experiments in which synthetic polyribonucleotides of known…

A: Hi dear, here's your answer.please like it .

Q: Why is specific base pairing essential to the processes of transcription and translation? - How many…

A: The DNA is composed of sugar and phosphate that serves as the backbone, and at each sugar, a…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:

A: This question is based on the functioning of mRNA expression.

Q: Aspartate and phenyalanine become apartate and isoleucine

A:

Q: Post-translational modification of proteins refers to the covalent and  enzymatic modification of…

A: The translation is a process by which the proteins are synthesized from the RNA. RNA polymerase and…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: Protein folding

A: Proteins are composed of some 20 types of amino acid residues, and they would be more or less alike…

Q: Which amino acid residue is preferred at which position in the following peptide for cleavage by…

A: While writing a polypeptide, the left side is the N terminus and the right side is the C terminus.

Q: TACTGCCTCCCCATAAGAATT

A: Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA…

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: Assume that the translational error frequency, d, is 1 * 10–4. (a) Calculate the probability of…

A: The probability that a protein molecule is completely error free is (1-δ)n, where n is the number of…

Q: You are studying the toxic protein called ectatomin, a major component of ant venom (specifically…

A: Proteins contain amino acids. They are linked to each other by peptide bonds. The amino acid such as…

Q: What are the sequences of all the possibletripeptides that contain the amino acids aspartic acid,…

A: Amino acids are the building blocks of proteins. They contain amino group, carboxyl group, and…

Q: The amino acids listed above that are coded by the mRNA codon

A: Protein synthesis is a major process inside our body .Our body has complex system for protein…

Q: Part of being a detective is being able to decode secret messages left behind by certain…

A: The given DNA sequence is: 5'- TATGCTAGGCATTGTCGTAGGCATACG -3' 3'- ATACGATCCGTAACAGCATCCGTATGC -5'

Q: Gene editing is also used to explore the structure and function ofproteins. For example, changes can…

A: From the observations, it gets clear that the amino acid aspartate shows the most functional…

Q: How many different polypeptides would you expect to see synthesized by an in vitro translation…

A: The mRNA is a sequence of ribonucleotides that contains three possible reading frames. Only one…

Q: Use the table below to help you answer the following question. THE CODON TABLE FIRST POSITION SECOND…

A: Ans- Tyrosine was replaced with cysteine.

Q: What polypeptides would be formed from the sequence UCAATGGGGUUUAUAGCG… (there are bases after the…

A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…

Q: Hello , please help me with this question. I am struggling with naming the Amino Acid sequence from…

A: Codon is the triplet of either DNA or RNA nucleotides which codes for a specific amino acid during…

Q: Shown below is a portion of a DNA sequence ( 31 base pairs long ) that encodes the last amino acids…

A: The process of synthesis of messenger RNA with the help of template DNA strand is called…

Q: Please explain why it is useful that our RNA is read in codons. Imagine a hypothetical scenario…

A: DNA or Deoxyribonucleic Acid acts as a hereditary material of almost all biological entities (some…

Q: Choose a pentapeptied composed of five different amino acids.  List the five amino acids.…

A: mRNA strand is synthesized from the template strand of the DNA by transcription. This mRNA is…

Q: Here is our DNA sequence: T-A-C-A-T-G-T-T-T-A-G-G-T-C-C-A-C-C-C-G-T-G-G-G-A-C-T Write the RNA…

A: Introduction  The process by which the genome's DNA is copied in cells is known as DNA replication.…

Q: How many possible nucleotide sequences could code for a peptide with the sequence "MRRTGERS*"? (Note…

A: The given sequence is 'MRRTGERS*'. The amino acid sequence is…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: 5’ GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG 3'  From above sequence…

Q: Give the amino acid sequence with some little explanation please.   5′…

A: Decoding a sequence of bases in mRNA results in the formation of either peptide, polypeptide, or…

Q: Examine Table 15-2. What do the following codons specify:a. UAAb. UGAc. UAGWhat happens when a…

A: Step 1 Genetic codes are genetic information present in the nucleotide sequences of DNA…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: During planetary exploration a new life form is discovered which has a DNA genome containing 6…

A: A genetic code is defined as the blueprint for the synthesis of proteins. Normally, three nucleotide…

Q: Arrange the following steps in correct sequence. Translation 1. Formation of the peptide bond 2.…

A: The nucleotide is the most fundamental component of nucleic acids. The polymers RNA and DNA are made…

Q: To visualize the spatial arrangement of amino acid residues in an a-helix, it is helpful to imagine…

A: Alpha helix is a secondary structure of protein. The alpha-helix can be right-handed or left-handed.…

Q: Assume that the translational error frequency, δ, is 1 x 10–4.(a) Calculate the probability of…

A: mRNAs are used to form protein by translation. The translation is performed using ribosomes, t-RNA…

Q: These are portions of the coding strands of DNA for Wild-Type Hemoglobin and the mutated hemoglobin…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Use this mRNA coding sequence as your starting point. This sequence begins with a start codon and…

A: A frameshift mutation in a gene is when nucleotide bases are added or removed in increments that are…

Q: Assume that the translational error frequency, 8, is 1 × 10-4. (a) Calculate the probability of…

A: The translation is the process of making a polypeptide chain from mRNA. The translation is catalyzed…

Q: Choose any pentapeptide composed of five different amino acids.  List the amino acids.  Present one…

A: INTRODUCTION In cells, messenger RNA is a molecule that transports information from the nucleus to…

Q: Suppose that there is a protein consisting of two polypeptide chains with the given sequences in the…

A: Edman degradation, which was invented by Pehr Edman, can be used to determine the amino acid…

Q: Lactose Permease is roughly 45 kDa in size. Approximately how many nucleotides in length is the…

A: Lactose permease is a membrane protein serving as a transport system for lactose into the E. coli…

Q: AAAGAGAAAAGAAUA to AAAGAGAAAUGAAUA. Suppose the codon sequence has a single base pair mutation If…

A: Introduction:  Mutations are changes in the genetic material or character of an organism. It can…