The RNA-induced silencing complex (RISC) I. binds to and unwinds ds siRNA/MIRNA to produce ss siRNAs/MIRNA. II. creates a block and inhibits translation when the ss siRNA matches the MRNA. III. mediates the degradation of the siRNA or miRNA to repress gene expression. O l only O Il only O l and II O Il and I!!

Q: RNAi...  result in product of dsrna or sirna to sirna or mirna! does it increase or decrease…

A: RNA i or RNA interference is a natural process occurs; in most of the eukaryotes;post…

Q: Which of the processes listed below are common in the post-transcriptional modification of…

A: mRNA is synthesized using DNA as template by a process called transcription. mRNA is generally…

Q: What is the purpose of alternative splicing a. Alternative spiicing allows a protein to be included…

A: RNA splicing is the process of removal of introns(non coding sequences) from newly made mRNA…

Q: Which of the following mechanisms may create multiple mRNAsfrom the same gene?a. posttranslational…

A: Introduction  A genome is consisting of transcriptionally active genes. These genes form mRNA as…

Q: In humans miRNA-143 regulates a specific MAPK gene. miRNA-143 binds to the MAPK MRNA and leads to…

A: Micro RNA or miRNA are the regulatory sequences generally found in plants, animals, and viruses.…

Q: Match each of the following descriptions to the type of regulatory RNA affecting a "target" gene…

A: Of course! Let's break down each match:This regulatory RNA may increase transcription of the target…

Q: A gene is constitutively expressed when it is: a. always copied into RNA, and the RNA is always…

A: Gene expression is a fundamental process within living organisms, tightly regulated to orchestrate…

Q: The RNA-induced silencing complex (RISC) _____ i. Binds to and unwinds ds siRNA/miRNA to produce…

A: The answet is b. II only RNA-induced silencing complex(RISC) is a multiprotein complex which…

Q: miRNAS P. are synthesized as long pri-miRNAs (up to 1000 nucleotides). Q. are transcribed by RNA…

A: Micro RNAs are found in animals, plants and some viruses. These are single stranded RNA molecule…

Q: Select one or more: O a. by the interaction of Rho and Rho binding sites in RNA. O b. by the…

A: Transcription is the process of making mRNA from DNA.it is always in the 5' to 3' direction.

Q: Which of the following is least related to the other items? Group of answer choices inducer…

A: 1) Inducer regulate gene expression. It activate transcription of a gene by inactivating repressor.…

Q: Let’s suppose that the overexpression of a particular miRNA was associatedwith pancreatic cancer.…

A: Answer is b.) A DNA -demethylating agent .

Q: 1. The SRP is recognized by the SRP receptor. 2. The ribosome translates the protein through the…

A: NOTE- as per our bartleby guidelines we are not allowed to answer more than one question at a time…

Q: Select from the drop-down menu which type of regulation is occurring in each case. The Ixb12 gene…

A: Gene regulation is a mechanism of controlling the function of gene and it's associated mRNA and…

Q: The foloving dagram represents a transcription unit (a gene) and corresponding RNA transcripts being…

A: The piece of DNA that take part in transcription is called transcription unit. Transcription unit…

Q: If the lac operon is "on" and transcribed, what is produced by RNA polymerase? O a. RNA polymerase…

A: The lac operon is a group of genes that work together to regulate the metabolism of lactose in…

Q: How would you describe the "purpose" of alternative splicing? Alternative RNA splicing... is a…

A: Nucleic acid is a macromolecule present inside the nucleus of cell . It stores genetic material and…

Q: Which of the following is NOT true of miRNAs?   A. Pri-miRNAs are processed by Drosha in the…

A: A microRNA, also known as a miRNA, is a single-stranded, non-coding RNA molecule that is very small.…

Q: . Which of the following is an example of post-transcriptional gene repression?a. The amount of RNA…

A: Post-transcriptional gene repression means the expression of the gene in the form of protein is…

Q: The T7 RNA polymerase has been used for production of recombinant proteins in E. coli cells. This is…

A: Question - The T7 RNA polymerase has been used for production of recombinant proteins in E. coli…

Q: . rat liver mannan-binding protein gene yields two different mRNA sizes 1.4 and 3.5 kb identify…

A: Pre transcriotion contol involved in DNA methylation and chromatin packing . Transcription control…

Q: 35. rat liver manan-binding protein gene yields two different mRNA sizes - 1.4 and 3.5kb identify…

A: Mannan-binding protein (MBP), a mannose-binding lectin (MBL) protein, is a protein involved in the…

Q: You saw this figure many times during the WC1 group work.   To get from the biomacromolecule(s)…

A: Biomacromolecules are the complex polymers of different monomer units (simple). In a human body,…

Q: A mutation in the trp repressor gene that prevents the apo-repressor from binding the co-repressor…

A: Tryptophan operon Tryptophan operon is negatively regulated operon, it includes five gene, promotor,…

Q: Compare and contrast miRNAs and siRNAs [may have more than one correct answer]. A Both miRNA and…

A: "siRENA" is likely a misspelling of "siRNA" (small interfering RNA). There's no known biological…

Q: Explain How can you study protein Z in these cells? (needed)

A: The tumor suppressor gene directs the production of a protein that regulates cell growth during cell…

Q: Alternative RNA splicing O is a mechanism for increasing the rate of transcription can allow the…

A: Alternative splicing It is also known as alternative splicing or differential splicing. It is called…

Q: Which mechanisms are used by miRNAs to regulate expression? O Targeted degradation of mRNAs O…

A: Introduction: MicroRNAs (miRNAs) are non-coding endogenous single-stranded RNAs that play an…

Q: The nr2f5 gene is transcribed into mRNA in both neurons and glia. The microRNA miR-5xb has partial…

A: Introduction  The expression of genes is highly regulated in both prokaryotes as well as in…

Q: In the lac operon, regulation of gene expression by CAP-CAMP is a type of O a. positive repressible…

A: Lac operon can be defined as the set of  constitutive genes with a single promoter that encodes for…

Q: tight packing of previously less condensed chromatin   identify which describes the statement…

A: Post translational modifications in histone proteins can change the shape of chromatin, which can…

Q: Which of the following is true of TATA boxes

A: Transcription is the process of synthesis of mRNA using DNA as a template. The process uses DNA…

Q: Alternative RNA splicing

A: Alternate RNA Splicing   It is a mechanism during gene expression where a single gene code for…

Q: Translate the following mRNA transcript   5’CGCCGAUGCGCGAUAUGUGGUAA’3   A. RRCAICG   B. ADARYVV   C.…

A: mRNA, or messenger RNA is a type of RNA (ribonucleic acid) that plays a crucial role in the process…

Q: What is a response element? A response element is a sequence of help in gene (DNA or RNA) that binds…

A: Hi, Thanks For Your Question.  Answer : What is a response element? 1. A response element is a…

Q: When an ncRNA functions as a decoy, ita. contains binding sites for many different proteins,…

A: Non-coding RNA (ncRNA) refer to the RNA molecules that are not translated into proteins. The…

Q: microRNAs (miRNAs) play important roles in gene regulation. What is the correct order of steps…

A: A class of short, endogenous RNAs with a length of 21–25 nucleotides (nts) is known as microRNAs…

Q: You perform a northern blot to determine whether CFTR (Cystic fibrosis transmembrane conductance…

A: Cystic fibrosis transmembrane conductance regulator gene is involved in mucus, sweat and digestive…

Q: In terms of gene expression, the regulation of lac operon is an example of? A.…

A: In bacteria, an operon is a collection of genes that are transcribed as a single mRNA molecule by a…

Q: . Based on this information, which of the following statements would be supported by these results?…

A: BRCA1  It is a human tumor suppressor gene and suppress the growth of tumor cells.

Q: microRNAs (miRNAs) play important roles in gene regulation. What is the correct order of steps…

A: Small RNA molecules called microRNAs (miRNAs) are essential for controlling gene activity. They…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.