• The image shows the sequence of tandem repetitive DNA (highlighted in green) at one locus in the genome, with the copy of the locus on each chromosome within the homologous pair shown (and listed as #1 and #2). Answer the following questions. 。 What type of repetitive DNA is shown? [Select] • You want to do a PCR of this locus. If one primer's sequence is 5'-TCGAGGTTC-3', then what is the second primer sequence needed to accurately PCR the locus? Choose a primer of 9 bases long. [Select] 。 You follow the PCR with an agarose gel electrophoresis. When preparing for agarose gel electrophoresis, which electrode should be placed nearest the starting point of the sample (the product of the PCR)? [Select] 。 Which allele would travel less far in your gel? [Select] #1: 5'-TCGAGGTTCCAACAACAACAACAACAACAACAACAACAAGGATCTACT-3' 3'-AGCTCCAAGGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTCCTAGATGA-5' #2: 5'-TCGAGGTTCCAACAACAACAACAACAACAACAACAACAACAACAACAACAAGGATCTACT-3' 3'-AGCTCCAAGGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTCCTAGATGA-5'

• The image shows the sequence of tandem repetitive DNA (highlighted in green) at one locus in the genome, with the copy of the locus on each chromosome within the homologous pair shown (and listed as #1 and #2). Answer the following questions. 。 What type of repetitive DNA is shown? [Select] • You want to do a PCR of this locus. If one primer's sequence is 5'-TCGAGGTTC-3', then what is the second primer sequence needed to accurately PCR the locus? Choose a primer of 9 bases long. [Select] 。 You follow the PCR with an agarose gel electrophoresis. When preparing for agarose gel electrophoresis, which electrode should be placed nearest the starting point of the sample (the product of the PCR)? [Select] 。 Which allele would travel less far in your gel? [Select] #1: 5'-TCGAGGTTCCAACAACAACAACAACAACAACAACAACAAGGATCTACT-3' 3'-AGCTCCAAGGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTCCTAGATGA-5' #2: 5'-TCGAGGTTCCAACAACAACAACAACAACAACAACAACAACAACAACAACAAGGATCTACT-3' 3'-AGCTCCAAGGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTCCTAGATGA-5'

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter18: Dna Technologies: Making And Using Genetically Altered Organisms, And Other Applications

Section: Chapter Questions

Problem 1ITD: You learned in the chapter that an STR locus is a locus where alleles differ in the number of copies...

See similar textbooks

Similar questions

You learned in the chapter that an STR locus is a locus where alleles differ in the number of copies of a short, tandemly repeated DNA sequence. PCR is used to determine the number of alleles present, as shown by the size of the DNA fragment amplified. In the Figure below are the results of PCR analysis for STR alleles at a locus where the repeat unit length is 9 bp, and alleles are known that have 5 to 11 copies of the repeat. Given the STR alleles present in the adults, state whether each of the four juveniles could or could not be an off-spring of those two adults. Explain your answers.
For separating DNA of different sizes, you would use Question PCR Questi Gel electrophoresis Restriction enzymes 1 Listen Crispr For making specific DNA changes in living organisms, you would use ** Crispr Restriction enzymes Gel electrophoresis PCR ◄0 Listen You are interested in identifying genes that determine tail length in dachsunds. You analyze the genome of several dachsunds and look for SNPS that correlate with tail length. The results are shown here pog Spot Rover Chase Frisbee Cin Checkers SNP 1 SNP 2 SNP 3 Tail Length (cm) 10 12 SNP 4 9 4 3 10 SNP 1 C C C G C SNP 2 A T T A A T Based on these results which SNP is best correlated with tail length SNP 3 C C C G C SNP 4 G G T T T G
• Suppose you perform a PCR that begins with one double-strand of the following DNA template: +5'-CTACCTGcoGOTTGACTOCTACCTTcccaGGATaccCAAAArTCTOGAG-3 +3-GATOGACOCCAACTGACGATGGAMGCCCTACOOUTITTAAGGCTC-S'+ A. Draw one cycle of PCR reaction below the following diagram. B. Label the template DNA, the primers, and what is happening at each step. temprature (2) eyntee
Below are 9 possible primer pairs.● Determine which primer pair is the best choice.● Explain why the other primers are not good choices.● Calculate the Tm for each primer. Underline or highlight the region of DNA for the primer pair you chose as the best.Forward 1: 5’ gaaataattttgtttaactttaag 3’ Tm =Reverse 1: 5’ gtttaagacaaaatagtctgg 3’ Tm =Forward 2: 5’ gtaactcagctttcaggtcg 3’ Tm =Reverse 2: 5’ tctcggaatgttgcaacagc 3’ Tm =Forward 3: 5’ agattagcggatcctacctg 3’ Tm =Reverse 3: 5’ atgtgtaatcccagcagcag 3’ Tm =Forward 4: 5’ cattgattatttgcacggcg 3’ Tm =Reverse 4: 5’ aaaatcttctctcatccgcc 3’ Tm =Forward 5: 5’ tccataagattagcggatcc 3’ Tm =Reverse 5: 5’ tgcaagcttggctgttttgg 3’ Tm =Forward 6: 5’ gatcctacctgacgcttttta 3’ Tm=Reverse 6: 5’ aaataatgaattcgagctcggt 3’ Tm =Forward 7: 5’ataaaaaaatcgagataaccgtt 3’ Tm =Reverse 7: 5’aggtcgactctagaggatc 3’ Tm =Forward 8: 5’ctacctgttccatggccaac 3’ Tm=Reverse 8: 5’ ttcgggcatggcactcttg 3’ Tm=Forward 9: 5’ tccataagattagcggatcc 3’ Tm =Reverse 9: 5’…
For the following short sequence of double stranded DNA, design primers (just ~ 3-4 bases) and show 2 copy cycles of PCR (refer to figure 13.25) for the amplification of this sequence of DNA (so that you have 4 double stranded DNA). 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’
Your graduate advisor asks you to amplify the following sequence of DNA by PCR: 5’-ATACGCATTCGGACCAGGTCCTAA-3’ 3’-TATGCGTAAGCCTGGTCCAGGATT-5’ a. To ensure that the entire sequence above is amplified, what 6-nucleotide DNA primers should you add to your PCR mix? You order the primers listed above, but instead receive the following set of primers: 5’-CGCATT-3’ 5’-GGACCT-3’ b. What portion of the double stranded DNA molecule will be amplified after 10 rounds of PCR? Your labmate attempts to rescue your PCR reaction by providing you with the following set of primers: 5’-ATACGC-3’ 5’-TCCTAA-3’ c. What is the result of running the PCR reaction with your labmate’s primers? How many double stranded molecules of DNA will result from 10 rounds of amplification?
BOTTOM The sequence depicted on the gel is 5'-GTGATGTAG-3' The sequence depicted on the gel is 3'- GTGATGTAG -5' The sequence shown on the gel is the sequence of the template strand of the reaction The sequence shown on the gel is complementary to the template strand of the reaction The template strand of the reaction is antiparallel to the sequence shown on the gel The largest fragment shown on the gel is closest to the top The largest fragment shown on the gel is closest to the bottom Each of the fragments shown on the gel have a primer incorporated at their 5' end Each of the fragments shown on the gel have a primer incorporated at their 3' end The number of nucleotides in the shortest band on the gel is 21 The number of nucleotides in the longest band on the gel is 21 ick Save and Submit to save and submit. Cick Save All Answers to save all answers.
1234 5 6 7 8 9 10 11 HALL Polymerase Chain Reactions were run on a microsatellite (Short Tandem Repeat) locus. The PCR products were loaded onto the wells at the top of the gel and separated by gel electrophoresis. A DNA standard size ladder was run in Lane 5. • Was the negative electrode or the positive electrode positioned closer to the bottom of the gel? • Choose one lane represents a sample from a person who is heterozygous for this gene locus. Identify one of the people who had an allele with the greatest number of repeats at this locus.
The results of the diagram (Agarose electrophoresis photodocumentation and quantification table) correspond to the information for 4 samples of genomic DNA extracted from plant tissue. With which sample (s) could a PCR be performed to amplify a 100 pb region? Al A2 АЗ А4 ID DNA 260 nm 260 nm (pb) 10,000 sample (ng/uL) 280 m 230 nm A1 170 1.9 2.0 А2 180 1.5 1.5 5,000 АЗ 170 1.7 1.5 А4 170 1.9 2.0 1,000 500 100 choose the best option: а. All b. None с. А2 d. A1, A2 е. А1
Following PCR amplification of a disease gene, you perform sequence analysis using a primer 20 nuclear tides in length. partial results are depicted on the gel below which of the following are true?
HELP EMAIL 19 The following DNA fragment shows where a number of restriction endonucleases cut sites occur within the fragment. The numbers below indicate the distance between those cut sites in base pairs (bp). Sall Eoo R P Bam Xhe Bam Ee R Kan 100 200 300 400 s00 s00 800 00 1000 1100 1200 1300 1400 1600 1600 1700 100 1000 2000 700 The gel below shows: • a DNA ladder with markers every 200 bp (DNA Ladder) • the resulting restriction fragments of the above DNA fragment if it was completely digested with the restriction endonuclease Xho / (Xho I Digest) • the resulting restriction fragments of the above DNA fragment completely digested with unidentified restriction endonuclease(s) (lanes A through F) Which two restriction enzymes where used to completely digest the DNA fragment above based on the results shown in Lane C of the gel below? Choose two restriction endonucleases below. Both answers need to be correct to get the full mark for this question. Lanes DNA Ladder Xho Digest A B. D.…
The following figure shows the FBI-style analysis of the genomic DNA of 10 people (1-10), and also of hair found at a crime scence left by the murderer [***]. This analysis involves the PCR amplification of SSR loci, each from a different (nonhomologus) chromosome. The PCR primers are for each SSR locus are labeled with a unique fluorescent molecule. Some bands are thicker because relatively more of the corresponding PCR product was obtained. The figure has dots aligned on both sides to help you find the crucial bands; it will help to use a straight-edge as a guide. The numbers at right are the total number of copies of the SSR locus among the population of 11 samples. Are any of individuals 1-10 probable relatives of the murderer? If so, identify this person and describe the degree of relationship to the criminal.