The coding sequence of insulin mRNA is 330 nucieotide long When it is translated to palypeptides, how many amino acids will the polypeptide contain? O 330 990 O 110 O 600
Q: A synthetic mRNA was made by linking together 5 G-A 3' dinucleotides. Which amino acid(s) would be…
A: The key enzyme involved in transcription is RNA polymerase, which synthesises a complementary strand…
Q: What is a common activating EGFR mutation in lung cancer? O deletion of codon 858 in exon 21 O…
A: EGFR stands for Epidermal growth factor receptor.These receptors are basically the family of…
Q: Mutation of codon 34 (CAC to GAC) and 85 (CGT to CAT) of the insulin gene causes hyperinsulinemia…
A: In codon 34, CAC codes for the amino acid Histidine. CAC is replaced by GAC which codes for Aspartic…
Q: The second MRNA molecute is the acias they code Ior. same as the original mRNA except it has an…
A: Mutation It is defined as the alteration in the sequence of DNA due to the exposure to some mutagens…
Q: DNA Sequence: TAC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCT GGC TCT CCA…
A: Any modification of a cell's DNA sequence. Mutations can occur as a result of errors made during…
Q: Write all the possible mRNA sequences that can code for a simple tripeptide segment Leu-Trp-Glu.…
A: Translation is the process of conversion of mRNA to protein . In this , Each codon is basically a…
Q: If a gene for a polypeptide has a mutation that causes an amino acid change but the new amino acid…
A: Mutation is molecular change in the DNA sequence of a gene. Mutations in the coding sequence of a…
Q: What is the amino acid sequence coded by this mRNA? MET SER ARG ASP VAL THR VAL LEU VAL SER O GLN…
A: A codon table can be used to convert a genetic code into an amino acid sequence. Because messenger…
Q: A single nucleotide addition and a single nucleotide deletion approximately 15 bases apart in the…
A: Gene is the structural and functional unit in the DNA. Genes are composed of nucleotide nitrogenous…
Q: The base sequence of the gene coding for a short polypeptide is 5’CTACGCTAGGCGATTGATCATC’3. What…
A: The process of formation of mRNA from template DNA sequence is known as transcription. The process…
Q: B. A polypeptide has 51 amino acids in its primary structure. (i) What is the minimum number of DNA…
A: Introduction DNA resides in the sequence of four nucleotides. The genetic code is a triplet code…
Q: The protein known as tyrosinase is needed to make certain types of pigments. Tyrosinase is composed…
A: Albinism is a genetic disorder in which there is a partial or complete loss of pigmentation.
Q: How long would the peptide be that is translated from this MRNA sequence: 5'-AUGGGCUACCGA-3'?a. 0b.…
A: TRANSLATION It is the process of peptide formation by the reading of mRNA in 5' - 3' direction.
Q: An mRNA has the following sequence:5′–AUG UAC UAU GGG GCG UAA–3′.Describe the amino acid sequence of…
A: Transcription DNA is converted to mRNA. this process is called transcription.
Q: An mRNA has the following sequence: 5′–AUG UAC UAU GGG GCG UAA–3′ Describe the amino acid sequence…
A: mRNA is a single-stranded RNA molecule that is complementary to one of the DNA strands of a gene. It…
Q: Which statement is false: A) Each type of protein ( ex: hemoglobin vs trypsionngen) varies in the…
A: Gene is a sequence of nucleotides that encode a particular protein. The transcription and…
Q: To create a functional hormone, insulin pre-mRNA is first made during the process of transcription…
A: The production of hormone ( Protein ):-Proteins are one of most abundant molecules with organic in…
Q: A gene affecting the behavioral outlook of individuals was discovered in several humans who can…
A: Transcription is the process of the formation of RNA from DNA. Through transcription, the…
Q: DNA Sequence: TAC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCG GCT CTC CCA…
A: DNA is the genetic material present in the cells of living beings.
Q: In which reading frame will this mRNA be read? 5'- ACAG C C U G CA A GU C A CU GACG- 3' O 1st O 2nd…
A: The order of amino acids in a protein from the N-terminus to the C-terminus is specified by mRNA…
Q: The human insulin gene contains a number of sequences thatare removed in the processing of the mRNA…
A: For Insulin production DNA recombinant technology is used where a bacterial vector is chosen into…
Q: 1. DNA Sequence: TẠC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCG GCT CTC CCA GTT GAA CT…
A: As per our guidelines, we are supposed to answer only one question. Please repost other question in…
Q: Some point mutations lead to an mRNA that produces a shorterpolypeptide. This type of mutation is…
A: Mutations could be defined as the sudden inheritable changes that occur in the genome of a given…
Q: 37 Transposons in eukaryotes are mechanistically different from bacterial transposons. Yes or no…
A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…
Q: What potential polypeptides can be produced from the following mRNA sequence? There are more than…
A: In our body genetic information is stored in form of DNA. DNA multiples itself by replication. DNA…
Q: A gene affecting the behavioral outlook of individuals was discovered in several humans who can…
A: DNA acts as genetic material in most organisms. DNA gets transcribed into mRNA by an RNA polymerase…
Q: The base sequence of the gene coding for a short polypeptide is 5’CTACGCTAGGCGATTGATCATC’3. a) What…
A: According to the central dogma, the information flows From DNA to proteins. DNA is transcribes into…
Q: In the case of the insulin receptor (IR), the RNA-binding protein RBP described in lecture in muscle…
A: RNA binding proteins bids to mRNA based on structure or sequence and form ribonucleoprotein…
Q: The aminoacyl- RNA synthetase enzymes are responsible for: O A. matching each TRNA with the…
A: Aminoacyl-tRNA synthetases enzymes is used in protein biosynthesis during translation process.…
Q: A polypeptide has 51 amino acids in its primary structure. (i) What is the minimum number of DNA…
A: A polypeptide is a single linear chain of many amino acids, held together by amide bonds. A protein…
Q: How many amino acids would be in this protein? Which of the five types of nitrogen bases is not…
A: Four types of aminoacids would be in this protein UCU--Serine AUU--Isoleucine GGG---Glycine…
Q: embryos are exposed to this drug during an early stage of organogenesis, they develop severe…
A: Hox genes are involved in embryonic development as well as in mechanisms in the adult body , thus it…
Q: GGGAGTGTATACGGGATGAAGGCGATT MRNA What’s the Protein And what’s the phenotype
A: The sequence of mRNA is CCCUCACAUAUGCCCUACUUCCGCUAA. CCC- PROLINE UCA - SERINE CAU - HISTIDINE AUG-…
Q: In eukaryotic mRNA there are 90 nucleotide involved in translation process. What is the number of…
A: Gene expression is a process by which the genes are turned on to form RNA and proteins. This is seen…
Q: Another thalassemic patient had a mutation leading to the production of an mRNA for the β chain of…
A: Thalassemias are hereditary blood diseases in which hemoglobin synthesis is reduced. Thalassemias…
Q: Mhich of the following polypeptides is coded for my the MRNA sequence 5' AUGGUUAAACGACAAUCC 3 ?
A: The amino acids are selected and wrote in the sequence as first, second and third base. The process…
Q: Atematve splicing of MRNAS in eukaryotic cells produces somewhat different proteins from a single…
A: Alternative splicing is the modification process of RNA(mRNA) by which an nascent mRNA is converted…
Q: Can you explain the answer and how to find it ? Number 1
A: Any Change in the genetic material, which is not caused by recombination, tnat leads to altered…
Q: What is the sequence of the mRNA transcript that will be produced from the following sequence of…
A: Transcription is the process of synthesis of RNA from DNA. RNA polymerase catalyzes this process by…
Q: If a stretch of mature mRNA to be translated has 300 bases, the resulting peptide will have O 300…
A: Amino acids are chemical molecules that contain the functional groups amine (NH2) and carboxyl…
Q: Write a possible mRNA base sequence that would lead to the production of this pentapeptide. (There…
A: mRNA is the abbreviation for messenger RNA, a type of single-stranded RNA involved in protein…
Q: Oxytocin is a small peptide hormone. It contains a nine amino acid sequence shown below: CYIQNCPLG…
A: In the production of a functioning gene product, gene expression is the mechanism by which genetic…
Q: The S-D (shine-Dalgarno) sequence is part of O a. 23S RNA in 50s subunit O b. 6S rRNA in 50S subunit…
A: Introduction In Bacterial And Archaeal Messenger RNA, The Shine–Dalgarno (SD) Sequence Is A Ribosome…
Q: A peptide sequence is composed of 10 serine residues. Determine how many different mRNA sequences…
A: A codon is a group of three nucleotides in an mRNA grouped to code for a particular amino acid. The…
Q: A synthetic RNA molecule with the sequence GCGCGCGCGCGCGCGCGCGCGCGCGCGCGC is mixed into the cell…
A: Synthesis of proteins from information on mRNA template on the ribosomal set up is termed as…
Q: A single nucleotide addition and a single nucleotide deletion approximately 15 bases apart in the…
A: During protein synthesis, the nucleotide sequence of the mRNA is read in the form of triplets.
Q: GAPDH is an enzyme that is involved in the glycolytic pathway. It is made of 330 amino acids in…
A: Enzymes can be defined as the type of catalysts in living organisms that increase metabolic…
Q: MCAD deficiency is an inborn error of metabolism. The coding strand is shown for the wild-type gene.…
A: DNA (deoxyribonucleic acid) is a double stranded molecule. One strand present in the 5’ to 3’…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- There is another melanocyte-stimulating hormone called β-melanotropin.Cleavage of β-melanotropin with trypsin produces the following peptidesplus free aspartic acid. WGSPPK DSGPYK MEHFRIf you assume maximum sequence similarity between α-melanotropin andβ-melanotropin, then what must the sequence of the latter be?Allosteric Regulation of Ribonucleotide Reductase by ATP and Deoxynucleotides Describe the underlying rationale for the regulatory effects exerted on ribonucleotide reductase by ATP, dATP, dTTP, and dGTP.5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 13
- On average, how many phosphoanhydride bonds (P;-P; bonds) are directly hydrolyzed in thecourse of synthesizing a 200 amino acid protein? Assume that you begin with the mature mRNA,ribosomal subunits, tRNAs, free amino acids, and all necessary factors.A chain NH3 NH3 B chain Gly Phe 2. The protein pictured below is bovine insulin. Determine the number and the size of the fragments that would be generated upon treatment with the following: İle Val Val Asn Gln Gln 5 Ġln 5 His look for the cleavage points (a) without DTT and (b) with DTT. Cys Leu Cys S-S Cys Without DTT With DTT Ala Ģly Ser Ser Trypsin 10 Val 10 His Cys Leu Chymotrypsin Ser Val Leu Glu BrCN Tyr Ala 15 Gln 15 Leu Leu Тyr Ġlu Leu Ásn Val Тyr Cys 20 Çys 20 Gly Asn Glu Arg Reagent (source) Trypsin (bovine pancrease) Chymotrypsin (bovine pancrease) Staphylococcus V8 protease Pepsin (porcine pancrease) Cyanogen bromide (chemical)(CnBr) Specificity Lys, Arg (C) Phe, Trp, Tyr (C) Glu, Asp (C) Phe, Trp, Tyr (N) Met (C) Gly Phe 25 Phe Тyr Thr Pro Lys 30 ÁlaAGUCAGUCAG The codon chart is shown below, what amino acid sequence does the MRNA sequence: 3' UUUCCUCAA 5' code for? RNA Codon Chart 31 Alanine G U A Tyrosine Stop Valine A G Cysteine U 3' U G Stop G Tryptophan 3' G 5' Arginine G U A Leucine Serine A Lysine A U Proline G Asparagine leucine-threonine-glutamic acid asparagine-serine-phenylalanine serine-histidine-glutamine phenylalanine-proline-histidine phenylalanine-proline-glutamine Serine Glutamic acid Aspartic acid Histidine Glutamine Arginine Isoleucine 2 Threonine Methionine Q
- (ol soupe bannos96 SAM 3 A small strand of DNA has this sequence: 0pxbeter owl nade hoparg TACCGGAAACTG ATGGCCTTTGAC a. If the TOP strand is the template strand, what will be the mRNA made from this DNA read from left to right? What process allows for the mRNA to be made? b. If this is a eukaryotic mRNA, where does transcription occur? What would happen if the mRNA was not processed? c. What is the sequence of the protein made (use the genetic code below)? What process allows for the protein to be made?Which of the peptide sequences below best matches the hydropathy plot shown? 5 10 15 Residue Number ILYYAGSREDHSGYLIL EQSDTERNQHGALIYLI LIFLAIFPAGSTSEDRR RAFLILFMTYFLILFLI LHGDQNRERDGHSQERD 2 Hydropathy value 0 -4 -25'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above sequence? Please use the one-letter code for your answers. (You will need to consult the Table of the Genetic Code for this question) 1st letter UUU Phe UCU UCC Leu UCA UCG U UUC UUA UUG CUU C CUC CUA CUG AUU A AUC AUA AUG U GUU G GUC GUA GUG CCU Leu CCC CCA CCG ACU lle ACC ACA Met ACG GCU Val GCC GCA GCG с Second Letter Ser Pro Thr Ala UAU UAC A | AAU AAC AAA AAG GAU GAC GAA GAG Tyr CAU CAC CAA Gin CAG 1 UAA Stop UGA Stop A UAG Stop UGG Trp G His Lys UGU UGC Asp Glu G 3rd Asn AGU Ser U letter AGC AGA AGG Cys U CGU CGC Arg CGA CGG GGU GGC GGA GGG DCAG DUAG DUCAG Arg Gly UCAG
- Given the peptide Val-Ser-Gln-Lys The lateral chain of one of these amino acids can be modified by N-acetylation. Write the semi‐developed form of the lateral chain of this modified amino acid at pH 7 The lateral chain of one of these amino acids can be modified by phosphorylation. Write the semi‐developed form of the lateral chain of this modified amino acid at pH 7.Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3 O met-ala-phe-lys-stop O met-ala-phe-lys- met-tyr-his-gly-val-stop-met-gly O met-ala-ser-gly-thr-stop O tyr-his gly-val-stop-met-ly O ala-phe-lys stopConsidering the given sequence of nucleotides in an mRNA molecule, (a) what is the sequence of the DNA template strand from which the RNA was synthesized? (b) What peptide is synthesized by this mRNA sequence? 5' GAG CCC GUA UAC GCC ACG 3'
