The code for a fully functional protein is actually coming from an mRNA transcript that has undergone post-transcriptional processing which is essentially way too different from the original code in the DNA template.        Given: GUC-CAC-UUA-ACC-CCU-GAG-GAG-AAA-UCG-GCC (Protein with known amino acid sequence)        Requirement:   Original DNA code. Itemize the steps you would take to get to know the original DNA code of the protein in focus.

Q: A Section of a Gene CTA AAA TAG TCT For the DNA sequence shown above, identify the following: mRNA…

A: A biological process in which the information present in DNA is copied to RNA (mRNA) is known as…

Q: Which of the following is not a term used to describe an unspliced mRNA? intronic mRNA O primary…

A: In eukaryotic genes, non coding DNA is also present. In most of the eukaryotic genes, coding…

Q: Transcribe the given DNA sequences to mRNA. DNA: 5'-GATCCGC-3' DNA: 5'-TTACGCTAA-3' DNA:…

A: INTRODUCTION The DNA and it's corresponding mRNA is given below.

Q: In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then,…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: This is a homework question that I have on my Adv. Anatomy & Physiology assignment. How to I got…

A: The hypothetical protein considered here consists of the amino acid sequence arginine,…

Q: Use the codon chart to determine the following RNA strand in amino acids (Remember to write it the…

A: Each codon is made up of three nucleotides, each of which corresponds to a single amino acid. The…

Q: Write if TRUE/FALSE. mRNA splicing takes place in bacteria. In eukaryotes, replication and…

A: FALSE. Explanation:mRNA splicing does not take place in bacteria. mRNA splicing is a process that…

Q: you are given a printout of the sense strand of your DNA.  The printout is shown below. The first…

A: Introduction: DNA is a double helix having a sugar-phosphate backbone like a ladder and the base…

Q: Describe the process of translating mRNA into proteins. Be sure to also include the following key…

A: The translation is known as a process in which protein is synthesized through the mRNA (transcribed…

Q: In cells, proteins are synthesized from a gene sequence via the process of transcription and…

A: In prokaryotes cell organelles are absent. The genomic DNA of prokaryotes is found in the cytoplasm.…

Q: pre-mRNA maturation to mRNA involves a guanosine nucleotide that is not part of the RNA polymer…

A: Deoxyribonucleic acid, or DNA, is a molecule that holds the information that allows an organism to…

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: describe a scenario (as you would to a 12th grader) a physiological situation (protein need) that…

A: CENTRAL DOGMA-  Replication is the process when DNA replicates itself means it will make copies of…

Q: describe the process of reading a gene and turning it into a protein in a eukaryote.Your first…

A: Transcription: The process of conversion of segment of the DNA to RNA is called as Transcription.…

Q: The set of mRNAs present within a cell changes over time.Explain.

A: The conversion of a liquid into a gas is known as boiling or vaporization. The temperature at which…

Q: The molecule(s) that actually recognize and translate the genetic code into polypeptide sequence are…

A: Translation of genetic code into polypeptide chain is called translation.

Q: a b Select one or more answers and submit. For keyboard navigation... SHOW MORE ✓ Transcription…

A: Introduction :- The process of transcribing a piece of DNA into RNA is known as transcription.…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: The sequence: ATTGCCGACGACTTG is complementary to a sequence that is used as a template in…

A: (-) Sense

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: Describe the steps (Initiation, Elongation and Termination) involved in translation of mRNA to…

A: All the living cells are made up of protein, which acts as building blocks for every organism. These…

Q: During translation elongation cycle, which of the following step(s) is/are repeated for each amino…

A: Translation is a process by which proteins are synthesized from mRNA template. It involves all the…

Q: Refer to a genetic code table for the question. below is a portion of the template strand of a…

A: The genetic code is a set of three-letter combinations of nucleotides called codons, each of which…

Q: The amino acids listed above that are coded by the mRNA codon

A: Protein synthesis is a major process inside our body .Our body has complex system for protein…

Q: Part of being a detective is being able to decode secret messages left behind by certain…

A: The given DNA sequence is: 5'- TATGCTAGGCATTGTCGTAGGCATACG -3' 3'- ATACGATCCGTAACAGCATCCGTATGC -5'

Q: cleotides                nucleus                      adenine                      cytosine…

A: The process in which DNA forms RNA is called transcription and the process in which RNA forms…

Q: Question / G 3 G2 G1 G 5 G 4 GGU AUG GCC AUG CUC CUc UUC ACG GAG UAC CGG R (the strand) Y CUC GAG…

A: In this image the process of transcription is shown where an mRNA is being translated with the help…

Q: After translation a protein needs to be folded correctly in order to function properly: C) What…

A: Proteins are long chains of amino acids. There are 4 types of proteins based on their structure:…

Q: True or False: When determining the transcription start site, there is a nucleotide position…

A: Question - True or False : When determining the transcription start site , there is a nucleotide…

Q: Shown below is a DNA coding strand: 5' T-A-C-T-T-C-C-C-G-A-T-C-A-T-T 3' Using the genetic code…

A: The genes in DNA encode protein molecules, which serve as the cell's "workhorses," performing all…

Q: Transcription and Translation Practice Directions: Read each sequence of DNA and transcribe it to…

A:

Q: What does SDS–PAGE stand for? What is the benefit of doing SDS– PAGE?

A: Electrophoresis is the migration of charged particles under the influence of an electric current.…

Q: This question refers to the mRNA sequence below: 5'-AGCUGAUGGGCUGGUGCCGAGAAAGUUAGGUAA-3' What is the…

A: During translation, the mRNA is read in triplets. The incoming tRNA reads the three bases at a time…

Q: All of the following are needed for capping of eukaryotic mRNA, EXCEPT   Question 27 options:…

A: Eukaryotic mRNA is a single-stranded ribonucleic acid. This is associated with the protein…

Q: The code for a fully functional protein is actually coming from an mRNA transcript that has…

A: Protein synthesis or translation process involve at least three steps- In the first step there is a…

Q: Translation work is an essential step for protein synthesis. In order for the protein to be…

A: The expression of genes includes two major process: transcription and translation. In transcription,…

Q: Match each aspect of transcription or translation

A: Central Dogma of Molecular Biology:It is a foundational principle that describes the flow of…

Q: (THIS IS NOT GRADED.) This is NON-MANDATORY homework for a practice assessment. I need some…

A: Translation what is the process of formation of a sequence of amino acids using messenger RNA as a…

Q: The genetic code is redundant (i.e., most amino acids are coded for by more than one codon). Why is…

A: Redundancy refers to differences in the third base of the codons coding for the same amino acid.

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: 5’ GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG 3'  From above sequence…

Q: List the differences in the loading of the tRNA and its alignment with the mRNA between the…

A: Translation It is defined as the process of translating the sequence of mRNA molecules to the…

Q: The initial step in the protein translation is described by: O release of the initiation factors…

A: There are 4 Biomacromolecules. They are ; Proteins Nucleic acids Carbohydrates and  Lipids

Q: 5' T A A G A G A 3' A A A AT HA

A: The complementary base pairing according to Watson-Crick model of B-DNA is as follows: 1. Adenine…