O antigen is a base oligosaccharide that is present in both A and B antigen. O True O False
Q: a reasonable biosynthesis for Compound 14 starting from Propose alanine, S-phenylalanine and ATP.
A: Given compound in a figure is Aspartame. Aspartame is a non-saccharide artificial sweetener that is…
Q: Propose a reasonable biosynthesis for Compound 14. MUST BE in this order: Acetyl CoA SAM S-alanine…
A: Here compound 14 is synthesized from L-Phenylalanine, SAM, L-alanine, and Acetyl-CoA in multistep…
Q: Iculate the actual, physiological deltaG for the reaction Phosphocreatine + ADP > creatine + ATP at…
A: Disclaimer: Since you have asked multiple question, we will solve the first question for you. If you…
Q: Which of the following statements are FALSE? Multiple answers:Multiple answers are accepted for…
A: Which of the following statements are FALSE? Multiple answers:Multiple answers are…
Q: 4. Complete the table below: RNA DNA Strand Sugar residue Nitrogenous bases Main Function
A: Nucleic acids are made up of nucleotides, which are the fundamental building blocks of DNA and RNA.…
Q: Break down this fatty acid. Show all the products made and the enzymes needed for any non-normal ß…
A: Fatty acids are building blocks of fats and composed of carboxylic acid with long aliphatic chain.…
Q: What is the Keq for the conversion of Glucose 6-Phosphate to Glucose 1-Phosphate if the phosphate…
A: Given- 1) Potential for Glucose 1-phsophate.- 20.9KJ/mol 2) potential for Glucose 6-Phosphate-…
Q: Eukaryotic polymerases have the same number of subunits as prokaryotic ones. True False
A: The process of creating an RNA copy of a gene sequence is known as transcription. The copy is known…
Q: Identify the ff nucleic acid bases and then classify whether it is a purine or pyrimidine.
A: Nucleic acids are also known as polynucleotides. Monomeric units of nucleic acids are called…
Q: When mixes with benedict's solution test tube A 4 amylase and starch will have what color and why
A: Amylase is an enzyme that helps to digest food. Most of our amylase is made in the pancreas and…
Q: One of the major problems in food chemistry is to make food gels maintain its shape and rigidity.…
A: Carrageenan are polysaccharides comprised of repeating disaccharide units of sulfate derivatives of…
Q: Arrange signalling cascade events in chronological order.…
A: Signaling pathways helps to respond the cells according to the external stimuli. The external…
Q: What part of the electron transport chain is responsible for the greatest contribution to oxidative…
A: Protein complexes are present in the inner membrane of mitochondria forming an electron transport…
Q: 8. In the Stomach: a. Is there digestion? YES or NO b. If YES, then answer i-iv to explain. If NO,…
A: Fats are esters of fatty acids , also called as lipids/triglycerides.
Q: There are two types of nucleic acids-DNA and RNA, both are composed of nucleotide subunits. Complete…
A: The nucleic acid polymer has nucleotide as its monomeric unit. synthesis of nucleotides is…
Q: ACTIVITY 7.2.2 Show and explain how exactly the condensation reaction to form a nucleotide happens.…
A: Nucleotides are the phosphoric acid esters of nucleosides with the phosphate group. Nucleotides are…
Q: Classify each protein as fibrous or globular. A. albumin B. myosin C. fibroin
A: Globular proteins are characterized by having globin like fold. Globin heme bonding protein with…
Q: 1) What is the chemical group at the end of the R groups of basic amino acids that makes them…
A: There are twenty standard amino acids that make up all of the proteins. The twenty standard amino…
Q: Which of the following is a drawback of using base hydrolysis during amino acid composition? A.…
A: The amino acids that occur naturally as constituents of proteins have an amino group (NH2) and a…
Q: 7. Which of the following statement is true? A. oxidative rancidity is observed more frequently in…
A: Introduction: Rancidity is the development of unpleasant smells in fats and oils that is often…
Q: 2. Calculate the overall charge (pH 7) on the following three polypeptides and answer the questions…
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have…
Q: Which of the following is the CORRECT relationship?
A: Phosphatidylinositol 4, 5 bisphosphate is known as PIP2 that is a component of cell membrane -…
Q: What are the different types of RNA? Where are these types located within the cell?
A: Introduction: The structure of RNA is made up of a repeating strand of nucleotides that contain all…
Q: Draw the structure (using chair confirmation of pyranose) of the following disaccharides. (a)…
A: Disaccharides are carbohydrates that, when hydrolyzed with acids or enzymes, provide two…
Q: 10. The degree of unsaturation of lipid can be measured as A. saponification number B. iodine number…
A: Saturated fats are the fatty acids in which the hydrocarbon chain with a carboxyl group contains…
Q: least likely affected by changes
A: The three-dimensional arrangement of atoms in an amino acid-chain molecule is known as protein…
Q: 25. What would be the new pH of a 1L buffer solution (pH=7.8) upon the addition of 3mL O.0001 M HCI.…
A: The new pH of a 1L buffer solution (pH=7.8) upon the addition of 3mL 0.0001 M HCI. (Buffer, pka=7.2)…
Q: When can we say that it is an essential amino acids and non essential amino acid? Choose two amino…
A: Introduction: Amino acids are biomolecules that contain an amino and a carboxyl group-containing a…
Q: state the form in which the energy is present in the carbonhydrate eaten by the ox
A: Carbohydrates, abbreviated as carbs, are sugar molecules. Carbohydrates are one of three major…
Q: The term rRNA refers to ______ RNA.
A: Ribosomal RNA is abbreviated as rRNA.
Q: Design the simple process scheme diagram for (fermentation and recovery of glutamic acid from palm…
A: The breakdown of carbohydrate under anaerobic condition is referred to as fermentation. In…
Q: *Which of the following statements about allosteric enzymes is NOT true? Question 10 options: - They…
A: Ezymes are boost up chemical reaction in body.allosteirc enzyme are type of Ezymes.Allosteric enzyme…
Q: Both choices B and D are correct.
A: Cholic acid which is also called as 3α,7α,12α-trihydroxy-5β-cholan-24-oic acid and represents as a…
Q: TRUE OR FALSE: 1. The 35S precursor is the precursor RNA transcript for all ribosomal RNAs except…
A: Ribosomal RNA is the component of Ribosomes which is essential for translation and forcing tRNA and…
Q: Which of the following statements is TRUE for nonpolar amino acid residues of polypeptides or…
A: They are hydrophilic and found buried within proteins FALSE. Water soluble proteins contain…
Q: What glycolytic intermediate does glycogenolysis produce? Explain in brief..
A: Glycolysis is a metabolic pathway in which glucose is converted to pyruvate. The principal sugars…
Q: Which of the following chromatographic techniques allows a faster elution of polar proteins? O…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: What are nucleic acids?
A: Carbohydrates, proteins, lipids, and nucleic acids are the four biomolecules, which are essential…
Q: a. What is isoelectric point? (Round your answer to two decimal places, for example: 0.13 or 1.45 or…
A: The isoelectric point (pI) is the pH at which a particular molecule carries no net electrical…
Q: Using linear regression analysis, determine the values of Vmax and Km of the enzyme in the ab- sence…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: 1. What is the physiologic function of pigments in plants?
A: Pigments are compounds that absorb specific wavelengths and reflect away, the other. Plant parts are…
Q: In a paragraph format How amylase is used/its purpose and why amylase useful in the food industry
A: Any enzyme that catalyses the hydrolysis (breaking of a substance by the addition of a water…
Q: How amylase is used/its purpose and why amylase useful in the food industry
A: Amylase are the Enzymes that can digest starch into small polymers of glucose units. They can…
Q: Enzymes
A: enzyme, a molecule that works as a catalyst in living organisms, controlling the pace at which…
Q: I. True or False a. The beta-pleated sheets are formed by H-bonds among adjacent regions of the…
A: A. FALSE - The beta-pleated sheets are formed by H-bonds between neighbouring strands.
Q: Why does it make sense that under conditions of low ATP levels in the cell the pyruvate carboxylase…
A: Pyruvate carboxylase (PC) is a ligase class enzyme which catalyze the irreversible carboxylation of…
Q: 29. Here is a strand of DNA: TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCC AAATCT…
A: DNA strand given here with directionality is as: 5’…
Q: does HEW have a higher concentration of negatively/neutral charged protein (at ph 7) explain ur…
A: HEW ( hen egg white) is an enzyme specifically known for its ability to degrade the polysaccharide…
Q: a deaminating agent 5-BU is that can base-pair ike cytosine or like if 5-BU is cytosine incorporated…
A: 5-Bromo Uracil and nitrous acid are mutagenic agents. It means both of these agents cause mutation…
Q: (Part A) Coenzyme-dependent enzymes can catalyze the general transformations shown below. What would…
A: The process of translation takes place in the cytoplasm which converts mRNA to…
Step by step
Solved in 3 steps
- Question 39 Forensic biology is historically also known as screening HLA Dqa ABO typing serology DNA profilingQuestion 106 106. Put the events of initial allergen sensitization in order. APC ingests, digests, and presents the allergen to B lymphocytes [ Choose ] [Choose ] plasma cells produce IgE against allergen second fırst IgE attach to mast cells third Question 107QUESTION 1 The table below shows the results from looking at the diagnostic accuracy of a new rapid antigen test for COVID-19 in 100000 patients, compared to the reference standard RT-PCR test. The rows of the table represent the test result and the columns the true disease status (as confirmed by RT-PCR). COVID-19 Positive COVID-19 Negative Antigen Test Positive Antigen Test Negative 424 795 8216 90565 Calculate the SENSITIVITY of this new rapid antigen test as percentage with 3 decimal places. (Assume that the RT-PCR reference has a 100% Sensitivity and 100% Specificity.)
- Question 108 108. Each antibody has at least antigen binding sites O 1 3 2.Question 21 Which normally will last a life time? O immunity from an injection of gamma globulin O naturally acquired, passively gained immunity O immunity gained from breast milk antibodies O naturally acquired active immunityQuestion 10 Blood group A has A antigen on the red blood cells with anti-A antibodies in the plasma. True False
- Question 4.2 Lymphocyte antigen receptor properties Homework • Unanswered Match the numbered lymphocyte antigen receptor property with the lettered answer that indicates the receptor type to which it applies. Drag and drop options on the right-hand side and submit. For keyboard navigation. SHOW MORE V Has no secreted form TCR Has two antigen binding sites BCR and TCR Has variable and constant regions BCR Recognizes PAMPS Neither BCR nor TCR II IIQUESTION 85 Lectin binds to certain carbohydrates to begin the activation of the classical complement pathway. O True O False QUESTION 86 Cytokines O play key roles in both specific and non-specific immunity and are required for regulation of the immune response. O cause lysis of invading microorganisms. O play key roles in both specific and nonspecific immunity. O are required for regulation of the immune response. QUESTION 87 Sulfonamides inhibit the production of folic acid and, therefore, inhibit the synthesis of O rībose O peptidoglycan O aromatic amino acids O purines and pyrimidinesQuestion 10 Gram Stain is used to differentiate. O 1. Virus O 2. Onion Cells O 3. Blood Cells O 4. Bacteria A Moving to another question will save this response.
- QUESTION 91 Drug resistance occurs against antibiotics and not against synthetic chemotherapeutic agents. O when antibiotics are taken after the symptoms disappear. because bacteria are normal microbiota. O when antibiotics are used indiscriminately. All of the answers are correct. QUESTION 92 What antibody predominates during secondary antigen exposures? O IgE O IgG O IgM O IgA O IgD QUESTION 93 Cytotoxic T lymphocytes are distinguished from other lymphocytes by the presence of O CD4 O CD8 O CD19 O All of the choices are correct.QUESTION 63 Class IlI major histocompatibility complex molecules are found on all of the following types of cells EXCEPT O dendritic cells O macrophages O B cells O red blood cells QUESTION 64 In general, the LD50 for exotoxins is much greater than the LD50 for endotoxins. O True O False QUESTION 65 Macrophages are derived from O monocytes O neutrophils O granulocytes O basophilsQuestion 11 Blood group BA has A and B antigens on the red blood cells with no anti-A and anti-B antibodies in the plasma. O True False