Which of the following is the CORRECT relationship?
Q: 2) a. Give the name of the following glycoside: но. он но но b. Draw the structure of the…
A: In the question 2a, the compound has D-mannose sugar linked to a phenyl ring with O-glycosidic bond…
Q: Under what pH conditions can a protein not bind to the beads in a column? pH = -pKa pH =…
A: Proteins are composed of amino acids. There are a total of twenty standard amino acids that make up…
Q: Explain why it is that the anticodon sequence AGG can bind to multiple different Serine codons. 2.…
A: The genetic codes are triplet of four bases ATGC and thus 43=64 codons are possible. These 64 codon…
Q: What is insulin resistance? Hypoglycemia? Hyperglycemia? Explain its similarities and differences
A: Insulin is a peptide hormone produced by the beta-cells of islets of Langerhans of the pancreas. It…
Q: 2. Calculate the overall charge (pH 7) on the following three polypeptides and answer the questions…
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have…
Q: During SDS-PAGE, the charge on glycine in the stacking gel is ____________ while the charge on the…
A: SDS-PAGE is used to separate proteins based upon the relative mobility of charged species. Proteins…
Q: How does a protein form?
A: Proteins are the heteropolymers of twenty standard amino acids attached together via peptide bonds.…
Q: 2. Glvcolate is oxidized into Glvoxylate by cytochrome Cusing the glycolate oxidase enzyme, The two…
A: Glycolate oxidase is a key enzyme involved in the conversion of glycolate to glyoxylate during…
Q: one more example of chemical (besides acids and alkalis) which can also affect DNA stability.…
A: DNA can be denatured by process of separating dsDNA into single strands, factors like temperature,…
Q: Suggest, which enzyme pathway come into play
A: Phenylalanine is an aromatic and non-polar amino acid, it is both glucogenic (Fumarate) and…
Q: Branched polysaccharides will be more viscous than linear polysaccharides. True False
A: The molecular formula of glucose is C6H12O6. Glucose is a building block of disaccharides like…
Q: Tabulate the main structural features of DNA and RNA. In one sentence, point out the salient…
A: Nucleic acids are made up of nucleotides. Nucleotides are the monomer units of nucleic acid.…
Q: Urease enzyme hydrolysed urea at [S]= 0.03 mmol/L with a Km value of around 0.06 mmol/L. The initial…
A: From the above data, S1 = 0.0.3 mmol/L km is around 0.06 mmol/L Initial velocity V01 = 1.5*10-3 V0…
Q: When can we say that it is an essential amino acids and non essential amino acid? Choose two amino…
A: Introduction: Amino acids are biomolecules that contain an amino and a carboxyl group-containing a…
Q: The term rRNA refers to ______ RNA.
A: Ribosomal RNA is abbreviated as rRNA.
Q: *Which of the following statements about allosteric enzymes is NOT true? Question 10 options: - They…
A: Enzymes are biocatalysts that increase the rate of a reaction by a factor of several. Living cells…
Q: Explained how metal ions help in enzyme action. Cite three vitamins that have antioxidant activities
A: The process of translation takes place in the cytoplasm which converts mRNA to…
Q: Explain the enzymes.
A: Enzyme, a molecule that works as a catalyst in living organisms, regulating the pace at which…
Q: *Which of the following statements about allosteric enzymes is NOT true? Question 10 options: - They…
A: Enzymes are protein molecules that increase the rate of reactions by decreasing the activation…
Q: ideroblastic anemia is observed in the deficiency of which of the following? * (Please choose one…
A: Vitamins are the organic compounds required for the proper functioning of the body. The vitamins are…
Q: Give at least two (2) chemical tests for amino acids/ proteins other than what were performed in…
A: In biochemistry , a chemical test is performed in qualitative or quantitative procedure to identify…
Q: Draw and name the covalent linkage between two deoxynucleotides. Indicate both the 5’ and 3’ end.…
A: Deoxyribonucleotides are the smallest units present in DNA. DNA is also known as deoxyribonucleic…
Q: 2. (: A diagram of the residues defining the binding site of 2,3-bis-phosphoglycerate (BPG) is shown…
A: 2,3 bis phosphoglycerate (BPG) is an allosteric regulator of Hb. BPG binds to central cavity of…
Q: Calculate the actual free energy of hydrolysis of ATP, delta Gp in the erythrocytes of a new…
A: Actual free energy (∆G) is the maximum amount of energy which is available to perform work. Standard…
Q: Most of the ultraviolet absorption of proteins at 280 nm is due to their content of O Tryptophan O…
A: Proteins in solution absorb UV light at 280 and 200 nm, exhibiting absorbance maxima at these…
Q: TRUE OR FALSE 1. In the structure of Aztreonam, addition of a moiety capable of Van de Waals…
A: Aztreonam is an antibiotic like penicillin and it inhibits the peptidoglycan crosslinking enzyme…
Q: 1. What is the physiologic function of pigments in plants?
A: Pigments are compounds that absorb specific wavelengths and reflect away, the other. Plant parts are…
Q: Which of the following is a drawback of using base hydrolysis during amino acid composition? A.…
A: The amino acids that occur naturally as constituents of proteins have an amino group (NH2) and a…
Q: What name is given to the predominant secondary structure found in silk?
A: Proteins exhibit 4 levels of structural organisation. They are primary structure, secondary…
Q: explain serotonin dopamine and gaba and its effects.
A: Serotonin, dopamine and gaba all are the neurotransmitters means all are chemical massengers of…
Q: Which of the following is an incorrect grouping of amino acids based on their properties of the side…
A: The pairing of the group is done right. Alanine, Leucine and Valine have non-polar side chains.
Q: Comparing stearate to palmitate, concerning beta oxidation, how many more ATP will be formed from…
A: After each cycle of beta oxidation, the fatty acid gets reduced by 2 Carbons and the end products…
Q: 8/9 Instructions; • Answer the Question properly and accordingly. • Do not copy here in Bartleby or…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: The enzyme is considered to be alan* COO COO H-C-OH Phosphoglyceromutase H-C-0- ČHO-P ČH,OH…
A: Enzymes are classified as oxidoreductases, transferases, hydrolases, lyases, isomerases, and ligases…
Q: Among these amino acid combinations listed above, only the combination of Lys and Glu have side…
A: The tertiary structure of proteins are stabilized by non covalent interactions like hydrogen…
Q: Which of the following WILL INCREASE gelling if addition of Ca2+ ions was added? a. starch b.…
A: Gelation is a process where formation of 3D network of polymers from monomers.
Q: 13. Which of the following is an example for derived lipids? A. steroids B. terpenes C. carotenoids…
A: Hi! Since you have posted multiple question, we shall answer the first question for as we are only…
Q: 1. Glucose synthesis was investigated in isolated hepatocytes. Different amino acids were added to…
A: Amino acids are building blocks of proteins which is consist of amine group, carboxylic group,…
Q: Which of the followingdescribe superior properties of enzymes (biological catalysts) over…
A: Enzymes are biocatalysts that are protein in nature. They Enzymes present a the particular substrate…
Q: Enumerate 10 examples of oxidation-reduction reaction that occur everyday.
A: Oxidation-Reduction reaction is also called redox reaction involves transfer of electron between two…
Q: Lysine is similar to ornithine. .Why does lysine not form a lactam? a. Infrequency of lysine…
A: A lactam is a cyclic amide (lactone+amide). A lactam antibiotic is an antibiotic that contains a…
Q: 5' 3' For numbers 6 to 10, refer to the image above and answer the questions. 9. How are Okazaki…
A: Okazaki fragments : These are pieces of DNA which are the transient components of the lagging strand…
Q: (d) ( through the disulfide bridge. If this bridge were found for the two joined amino acids free in…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: *Which of the following statements about allosteric enzymes is NOT true? Question 10 options: - They…
A: Ezymes are boost up chemical reaction in body.allosteirc enzyme are type of Ezymes.Allosteric enzyme…
Q: Draw the structure of following peptide: Glu-Asp-His-Cys-Gly-Arg (B) At pH= 10.7 (A) At pH= 2.1
A: Amino acids are organic compounds having two functional group namely carboxyl and amino. Amino acids…
Q: Explain when "formulated media" was chosen to be used as a medium in the fermentation process?…
A: A growth medium, also known as a culture media, is a solid, liquid, or semi-solid that is used to…
Q: A. Name the two proteins that induce a negative feedback in this pathway and explain why both…
A: Since, you have posted multiple questions we will solve the first question for you. If you want any…
Q: separating gel
A: here they talk about ion exchange chromatography and electrophoresis. Ion exchange chromatography…
Q: reaction
A: Hess law is mainly used to find out specific unknown enthalpy change. It is particularly useful for…
Q: Protein solubility
A: here they are talking about protein solubility. Protein solubility is a thermodynamic property…
![Question 8
Which of the following is the CORRECT relationship?
A PIP2 PIP3 - DAG
B) PIP2 = IP3+ DAG
C PLC = PIP2 + PIP3
D DAG = PIP2 + PIP3
E) PIP3 = IP3+ PIP2](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2F226e12a8-7f78-441a-835c-8cc634a6cd25%2F71ff354d-1bc3-4ccf-887b-9e9e1d561212%2Ffuquwak_processed.jpeg&w=3840&q=75)
![](/static/compass_v2/shared-icons/check-mark.png)
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- Question in Image, all one part! Thank you!QUESTION 7 You are trying to use qPCR to compare gene expression of nitrous oxide reductase (nosZ) in a Pseudomonas sample treated under various conditions. Using the 2-delta deltact method, about how much higher (or lower) is the expression of nitrous oxide reductase (nosZ) in the experimentally treated sample verses the untreated sample? nosZ Ct values for untreated sample (control conditions) Internal housekeeping nosz Ct values for Internal housekeeping gene Ct values for untreated sample (control conditions) gene Ct values for treatment sample experimental treatment sample experimental Replicate 1 21.3 20.0 19.8 20.9 Replicate 2 21.5 20.1 19.7 21.0 Replicate 3 21.4 20.3 19.5 20.7 Replicate 4 21.6 20.2 19.4 21.1 O A. -2 times higher B. -100 times higher C. about 20% as much as the control O D.-3.5 times higher O E. -12 times higher O F. -6 times higher than the controlQUESTION 8 An ultrasound wave bounces off a bone in a human body and back to the transducer in 3.1E-5 s. How far did it have to travel? For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac). BIUS Paragraph Arial 10pt - 田 田用因 Ť () Click Save and Submit to save and submit. Click Save All Answers to save all answers. +] 田
- QUESTION 56 PDGF HILL 100 PI3K PI3K 751 50 GAP O O GAP 771 protein Psite 1 2 PTP O 1009 O PTP PI3K 740, 751 GAP 771 1021 PTP 1009 PLC PLC PLC-y 1021 When activated by ligand binding, the PDGF (platelet-derived growth factor) receptor becomes phosphorylated on 5 tyrosine residues (left figure). These phosphorylated tyrosines serve as binding sites for proteins that contain SH2 domains (SH2 domains bind phosphorylated Y). These proteins include phospholipase C-gamma (PLC-gamma), a phosphotyrosine phosphatase (PTP), a Ras GTPase- Activating Protein (GAP), and a phosphotidylinositol 3-Kinase (PI3K). PDGF stimulates several changes in the target cell, one of which is DNA synthesis. To determine which effectors of the PDGF receptor is/are responsible for stimulating DNA synthesis, you construct several mutant forms of the receptor that retain individual or combinations of the phosphorylation sites. You express these in cells and monitor DNA synthesis. The results are shown the right figure.…Question:- 2-Human immunodeficiency virus (HIV) preferentially destroys helper T cells. Briefly explain why people who are infected with this virus develop acquired immunodeficiency syndrome (AIDS).Question 17 // Last tutor gave me this and its incorrect. I need the correct answer please.
- Question Completion Status: 1 3 4 10 11 12 Od. at a -2 disparity QUESTION 4 We observe two objects. One createsa projection on neurons 1, 2, 3 of both eyes: the other creates a projection on neurons 4, 5.6 of the left eye and on neurons 5, 6, 7 of the right eye. How would the final activation pattern over the grid in the Depth from Disparity network look like? O a There will be two activation clusters that fall on the main diagonal Ob There will be two activation clusters that fall on 2 different diagonals c. There will be one activation cluster that falls on the main diagonal and another that falls on the right column Od. There will be one activation cluster on the upper row QUESTION 5 Questions 5-12 refer to the Interactive Activation Model The word Dog would be represented in layer a. 1 b 2 c 3 d none of the aboveQUESTION 1 You want to perform PCR on the CDNA of the spike gene from a SARS CoV-2 sample so that you can sequence it. Based on the sequence below, which of the following primer pairs would probably work for PCR of this gene? Spike gene Sequence: 5' ATGTTTATTTTCTTATTATTTTTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATG ATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGGTT TACTATCCTGATGAAATTTT. .. (it's really long so didn't post the whole thing.).TCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAA GTTTG ATGAGGATGACTCTGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAA 3' Forward primer: 5' - CTC TCA CTA GTG GTA GTG ACC - 3' (Tm = 60.5 °C in a standard qPCR mix) Reverse Primer: 5' GGG TGT CAA ATT ACA TTA CAC ATA - 3' (Tm= 59.6 °C in a standard QPCR mix) Forward Primer: 5'- ATG TTT ATT TTC TTA TTA TT -3' (Tm=D 47.2 °C in a standard qPCR mix) Reverse Primer: 5'- GCA AGA ACC ACA AGA GCA TGC ACC -3' (Tm= 68 °C in a standard qPCR mix) Forward primer: 5' - CTC TCA CTA GTG GTA GTG ACC -3'…Question 66 When a cell membrane potential shifts from -70mV to -90mV we say the membrane has: O depolarized O repolarized O hyperpolarized O polarized A Moving to another question will save this response. 17 stv MacBook Air DII F2 F3 F4 F5 F6 F7 F8 @ %23 2$ へ 7 8 W R T Y D F C ンU) つ B LE # 3
- QUESTION 13 Match the primary sequence to its characteristics/function/fate N-signal signal-anchor stop-anchor nuclear localization sequence KDEL 1. found at carboxyl terminus of ER resident proteins, interaction with its receptor directs retrieval from Golgi 2. hydrophobic, interacts with SRP and translocon, becomes transmembrane helix 3. mostly hydrophobic, interacts with SRP, cut off 4. hydrophobic, interacts with translocon, becomes transmembrane helix 5. basic, interacts with importin-alphaQUESTION 56 PDGF 100- PI3K PI3K 50 GAPO 771 O GAP protein P-site 3 4 7. PTP O 1009 O PTP PI3K 740, 751 + GAP 771 1021 PTP 1009 PLC PLC PLC-y 1021 When activated by ligand binding, the PDGF (platelet-derived growth factor) receptor becomes phosphorylated on 5 tyrosine residues (left figure). These phosphorylated tyrosines serve as binding sites for proteins that contain SH2 domains (SH2 domains bind phosphorylated Y). These proteins include phospholipase C-gamma (PLC-gamma), a phosphotyrosine phosphatase (PTP), a Ras GTPase-Activating Protein (GAP), and a phosphotidylinositol 3-Kinase (PI3K). PDGF stimulates several changes in the target cell, one of which is DNA synthesis. To determine which effectors of the PDGF receptor is/are responsible for stimulating DNA synthesis, you construct several mutant forms of the receptor that retain individual or combinations of the phosphorylation sites. You express these in cells and monitor DNA synthesis. The results are shown in the right figure.…Question 1 options: The specificity pocket of the serine protease chymotrypsin, which interacts with Tyr and Phe-containing peptide sequences, contains a Ser residue. A research group is trying to modify chymotrypsin such that it has a low KM with Trp-containing peptides. Enter the name or abbreviation of an amino acid that the Ser could be mutated to that would likely have the desired effect. (Hint: look at the diagrams of the specificity pockets shown in the course slides, and consider how the Ser would need to change to account for the difference between Tyr/Phe and Trp.)
![Biochemistry](https://www.bartleby.com/isbn_cover_images/9781319114671/9781319114671_smallCoverImage.jpg)
![Lehninger Principles of Biochemistry](https://www.bartleby.com/isbn_cover_images/9781464126116/9781464126116_smallCoverImage.gif)
![Fundamentals of Biochemistry: Life at the Molecul…](https://www.bartleby.com/isbn_cover_images/9781118918401/9781118918401_smallCoverImage.gif)
![Biochemistry](https://www.bartleby.com/isbn_cover_images/9781305961135/9781305961135_smallCoverImage.gif)
![Biochemistry](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)
![Fundamentals of General, Organic, and Biological …](https://www.bartleby.com/isbn_cover_images/9780134015187/9780134015187_smallCoverImage.gif)
![Biochemistry](https://www.bartleby.com/isbn_cover_images/9781319114671/9781319114671_smallCoverImage.jpg)
![Lehninger Principles of Biochemistry](https://www.bartleby.com/isbn_cover_images/9781464126116/9781464126116_smallCoverImage.gif)
![Fundamentals of Biochemistry: Life at the Molecul…](https://www.bartleby.com/isbn_cover_images/9781118918401/9781118918401_smallCoverImage.gif)
![Biochemistry](https://www.bartleby.com/isbn_cover_images/9781305961135/9781305961135_smallCoverImage.gif)
![Biochemistry](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)
![Fundamentals of General, Organic, and Biological …](https://www.bartleby.com/isbn_cover_images/9780134015187/9780134015187_smallCoverImage.gif)