Homework Help is Here – Start Your Trial Now!
Science
Biology
my the on labeled Promoter 5' UTR Transcription start site wel each quest Coding region 5'-TACCCAGATAATATATACGCATGACACATATGGACACCGATTATAAAGATATCTACTGCCGCGAGAATTATAG-3' Translation start codon 3' UTR Translation stop codon For each DNA sequence below, there is a single nucleotide mutation in the DNA sequence. For all examples, the mutation is highlighted in orange. A codon table is provided on the second page for your reference. Answer each of the following questions for EACH DNA sequence: A) what type of mutation is shown based on the nature of the genetic change (frameshift mutation or point mutation; if a point mutation, transition or transversion) B) what type of mutation is shown based on the functional impact on the organism (frameshift, silent, missense, nonsense, noncoding) C) What do you predict the effect of that mutation will be on either the structure or function of a protein, or on the phenotype of the organism. Explain your answer. For this part, there are some examples where you should know exactly the effect of the mutation, and some where you may have to infer this information based on the location of the mutation.

my the on labeled Promoter 5' UTR Transcription start site wel each quest Coding region 5'-TACCCAGATAATATATACGCATGACACATATGGACACCGATTATAAAGATATCTACTGCCGCGAGAATTATAG-3' Translation start codon 3' UTR Translation stop codon For each DNA sequence below, there is a single nucleotide mutation in the DNA sequence. For all examples, the mutation is highlighted in orange. A codon table is provided on the second page for your reference. Answer each of the following questions for EACH DNA sequence: A) what type of mutation is shown based on the nature of the genetic change (frameshift mutation or point mutation; if a point mutation, transition or transversion) B) what type of mutation is shown based on the functional impact on the organism (frameshift, silent, missense, nonsense, noncoding) C) What do you predict the effect of that mutation will be on either the structure or function of a protein, or on the phenotype of the organism. Explain your answer. For this part, there are some examples where you should know exactly the effect of the mutation, and some where you may have to infer this information based on the location of the mutation.

Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:Elaine N. Marieb, Katja N. Hoehn
Chapter1: The Human Body: An Orientation
Section: Chapter Questions
Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...
See similar textbooks
icon
Related questions
Question

Please answer A, B, and C for codon sequence 4 only 

Use the sequence of DNA below as your reference point; this single-stranded DNA sequence is the coding strand of a gene, which means the mRNA sequence is identical (not complementary) to this sequence except that T’s are replaced with U’s. **You do not have to convert any part of the DNA sequence into a complementary strand for this part of the assignment – you should just use the DNA sequence as given.** Note: for simplicity, not every sequence needed for gene expression is included in this gene – for example, you won’t necessarily find a Shine Dalgarno sequence in the mRNA 5’ UTR. Use only the information labeled on the DNA sequence to answer each question. **Sequence Diagram Explanation:** - The sequence is labeled with different regions, such as the Promoter, 5’ UTR (Untranslated Region), Coding Region, and 3’ UTR. - Key annotations include: - **Transcription start site:** marked with an arrow at the beginning of the 5’ UTR. - **Translation start codon:** indicated by "ATG" in green within the Coding Region. - **Translation stop codon:** illustrated in red with "TAG" near the end of the Coding Region. 5’ - TACCCAGATAATTATATACCGCATGACACATATGG CACATTATAAGATATCTAGTGCCCGCAGAATTATAG - 3’ **Instructions for Each DNA Sequence with a Mutation:** For each DNA sequence below, there is a single nucleotide mutation in the DNA sequence. For all examples, the mutation is highlighted in orange. A codon table is provided on the second page for your reference. Answer each of the following questions for EACH DNA sequence: A) **What type of mutation is shown based on the nature of the genetic change** (frameshift mutation or point mutation; if a point mutation, transition or transversion). B) **What type of mutation is shown based on the functional impact on the organism** (frameshift, silent, missense, nonsense, noncoding). C) **What do you predict the effect of that mutation will be on either the structure or function of a protein, or on the phenotype of the organism. Explain your answer.** *For this part, there are some examples where you should know exactly the effect of the mutation, and some where you may have to infer this information based on the location of the mutation
Transcribed Image Text:Use the sequence of DNA below as your reference point; this single-stranded DNA sequence is the coding strand of a gene, which means the mRNA sequence is identical (not complementary) to this sequence except that T’s are replaced with U’s. **You do not have to convert any part of the DNA sequence into a complementary strand for this part of the assignment – you should just use the DNA sequence as given.** Note: for simplicity, not every sequence needed for gene expression is included in this gene – for example, you won’t necessarily find a Shine Dalgarno sequence in the mRNA 5’ UTR. Use only the information labeled on the DNA sequence to answer each question. **Sequence Diagram Explanation:** - The sequence is labeled with different regions, such as the Promoter, 5’ UTR (Untranslated Region), Coding Region, and 3’ UTR. - Key annotations include: - **Transcription start site:** marked with an arrow at the beginning of the 5’ UTR. - **Translation start codon:** indicated by "ATG" in green within the Coding Region. - **Translation stop codon:** illustrated in red with "TAG" near the end of the Coding Region. 5’ - TACCCAGATAATTATATACCGCATGACACATATGG CACATTATAAGATATCTAGTGCCCGCAGAATTATAG - 3’ **Instructions for Each DNA Sequence with a Mutation:** For each DNA sequence below, there is a single nucleotide mutation in the DNA sequence. For all examples, the mutation is highlighted in orange. A codon table is provided on the second page for your reference. Answer each of the following questions for EACH DNA sequence: A) **What type of mutation is shown based on the nature of the genetic change** (frameshift mutation or point mutation; if a point mutation, transition or transversion). B) **What type of mutation is shown based on the functional impact on the organism** (frameshift, silent, missense, nonsense, noncoding). C) **What do you predict the effect of that mutation will be on either the structure or function of a protein, or on the phenotype of the organism. Explain your answer.** *For this part, there are some examples where you should know exactly the effect of the mutation, and some where you may have to infer this information based on the location of the mutation
The image displays six DNA sequences, each labeled with a number. The sequences are oriented 5’ to 3’. Within these sequences, specific nucleotides are highlighted in different colors. 1. Sequence 1: - **5’ – TACCCG**AGATATATATATACGCCATGACACAT**ATG**GACACCGCATTATAAAGATATC**TAG**TGCCTGCGCGAATTTATAG – 3’** 2. Sequence 2: - **5’ – TACCCAGATATATATATACGCCATGACACAT**ATG**TG**ACACCGCAGATTATAAAGATATC**TAG**TGCCGCGAGAATTTATAG – 3’** 3. Sequence 3: - **5’ – TACCCAGATATATATATACGCCATGACACAT**ATG**GACACCGCATTATAAAGA**G**ATATC**TAG**TGCCTGCGCGAATTTATAG – 3’** 4. Sequence 4: - **5’ – TACCCAGATATATATATACGCCATGACACAT**ATGG**ACACCGCATTATAAAGATATC**TAG**TGCCGCGAGAATTTATAG – 3’** 5. Sequence 5: - **5’ – TACCCAGATATATATATACGCCATGACACAT**ATG**TG**ACACCGCATTATAAAGATATC**TAG**TGCCTGCGCGAATTTATAG – 3’** 6. Sequence 6: - **5’ – TACCCAGATATATATATACGCCATGACACAT**ATGG**ACACCGCATTATAAAGATATC**TAG**TGCCGCGCGAATTTATAG – 3’** Explanation of Highlights: - The orange "G" and "A" indicate specific nucleotide variations between the sequences. - The green "ATG" signifies a region of interest, perhaps a start codon. - The red "TAG" denotes another region of interest, potentially a stop codon or marker. Each sequence serves as a unique DNA strand with markers for genetic variation, possibly used for comparison or demonstration of
Transcribed Image Text:The image displays six DNA sequences, each labeled with a number. The sequences are oriented 5’ to 3’. Within these sequences, specific nucleotides are highlighted in different colors. 1. Sequence 1: - **5’ – TACCCG**AGATATATATATACGCCATGACACAT**ATG**GACACCGCATTATAAAGATATC**TAG**TGCCTGCGCGAATTTATAG – 3’** 2. Sequence 2: - **5’ – TACCCAGATATATATATACGCCATGACACAT**ATG**TG**ACACCGCAGATTATAAAGATATC**TAG**TGCCGCGAGAATTTATAG – 3’** 3. Sequence 3: - **5’ – TACCCAGATATATATATACGCCATGACACAT**ATG**GACACCGCATTATAAAGA**G**ATATC**TAG**TGCCTGCGCGAATTTATAG – 3’** 4. Sequence 4: - **5’ – TACCCAGATATATATATACGCCATGACACAT**ATGG**ACACCGCATTATAAAGATATC**TAG**TGCCGCGAGAATTTATAG – 3’** 5. Sequence 5: - **5’ – TACCCAGATATATATATACGCCATGACACAT**ATG**TG**ACACCGCATTATAAAGATATC**TAG**TGCCTGCGCGAATTTATAG – 3’** 6. Sequence 6: - **5’ – TACCCAGATATATATATACGCCATGACACAT**ATGG**ACACCGCATTATAAAGATATC**TAG**TGCCGCGCGAATTTATAG – 3’** Explanation of Highlights: - The orange "G" and "A" indicate specific nucleotide variations between the sequences. - The green "ATG" signifies a region of interest, perhaps a start codon. - The red "TAG" denotes another region of interest, potentially a stop codon or marker. Each sequence serves as a unique DNA strand with markers for genetic variation, possibly used for comparison or demonstration of
Expert Solution
steps

Step by step

Solved in 2 steps

SEE SOLUTIONCheck out a sample Q&A here
Blurred answer
Knowledge Booster
Genomics
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
  • SEE MORE QUESTIONS
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:
9780134580999
Author:
Elaine N. Marieb, Katja N. Hoehn
Publisher:
PEARSON
Biology 2e
Biology 2e
Biology
ISBN:
9781947172517
Author:
Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:
OpenStax
Anatomy & Physiology
Anatomy & Physiology
Biology
ISBN:
9781259398629
Author:
McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:
Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:
9780815344322
Author:
Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:
W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:
9781260159363
Author:
Martin, Terry R., Prentice-craver, Cynthia
Publisher:
McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Inquiry Into Life (16th Edition)
Biology
ISBN:
9781260231700
Author:
Sylvia S. Mader, Michael Windelspecht
Publisher:
McGraw Hill Education
SEE MORE TEXTBOOKS