Minghao, Mingyu's laboratory partner, was assigned to work on a double-stranded DNA (ds-DNA)sample isolated from a bacteriophage. After DNA sequencing, Minghao discovered that his ds-DNAisolate is composed of 3,462 base nucleotides with 621 G-C base pairs. Minghao needs your assistancein calculating the following:4. total number of base pairs in the ds-DNA isolate5. number of A, T, G, and C base nucleotides in the ds-DNA isolate6. total number of hydrogen bonds in the ds-DNA isolate7. melting temperature of the ds-DNA isolate in °C.

DNA is the genetic material present in our body. DNA structure is right handed double helix in which…

Answered: Minghao, Mingyu's laboratory partner,…

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OH
Write the complementary sequence for the following DNA sequence, in order from 3' to 5': Use all capital letters to write the DNA sequence. ▸ View Available Hint(s) 3'- TAGCTTCACTAGATTCGAA -5' 5' - CGATATTGAGCTAAGCTT-3′ Submit Previous Answers × Incorrect; Try Again
Four E. coli strains of genotype a+ b- are labeled 1, 2, 3, and 4. Four strains of genotype a- b+ are labeled 5, 6, 7, and 8. The two genotypes are mixed in all possible combinations and (after incubation) are plated to determine the frequency of a+ b+ recombinants. The following results are obtained, where M = many recombinants, L = low numbers of recombinants, and 0 = no recombinants:On the basis of these results, assign a sex type (either Hfr, F+, or F-) to each strain.
You have begun your career in medicinal biochemistry and have just discovered a bacterial DNA plasmld (transferabl ring of DNA) that appears to destroy the Ebola virus. In order to characterize your new plasmid, the molar mass of the plasmid must be determined. You dissolve 25.00 mg of the purified plasmid in 0.200 mL of water at 2 °C and find the osmotlc pressure of this solution is 1.20 Torr at 20 °C and 1 atm pressure. Answer the following about the Ebola-killing plasmid. 33.) The osmotlc pressure of the system is: (a) 1 atm (b) 0.016 atm (c) 6.5 X 10-5 atm (d) 22.59 atm (e) 0.0016 atm
The sequences below indicated the 6bp recognition site for the restriction enzyme EcoRI. The lines indicate the sites where the enzyme will cut each strand. 1). write the sequence and structure of the two DNA pieces after the enzyme cuts (hydrogen bonds holding the strands together between the lines are broken after enzyme cuts) 2). indicate whether EcoRI generates blunt or sticky overhangs 5'- G I A A T T C - 3' 3' - C T T A A l G - 5'
In hybridizing microarrays, we use a solution that contains {3X SSC, 0.5% SDS, 5ug/ml salmon sperm DNA, 5% glycerol}. Describe how to make 100ul of this solution using stocks of 20X SSC, 10% SDS, and 10 mg/ml salmon sperm DNA, sheared, in water. Note that Molecular Biology Grade H2O must be used in making up this solution.
If you had the RNA sequence below: 5'UUUGGAG 3' and you were going to make a piece of DNA that would be a complement to it, what would the DNA sequence be? 5' 3' What 12-nucleotide primer would you use in the PCR technique when you want to amplify a gene whose end is as follows: 3' CGGCTCGACAAGGTG5' ? 5' 3'
You have two tubes, each with a pair of DNA fragments inside them. Tube #1 has fragments that are 500bp and 1000 bp in length. Tube #2 has fragments that are 7500bp and 8000bp in size. If you were to perform agarose gel electrophoresis and run the contents of each tube in two separate lanes on the same gel, what would you expect to see? O That the difference between the distances migrated by the two fragments in Tube #1 was much greater than the difference between the distances migrated by the two fragments in Tube #2. O That the difference between the distances migrated by the two fragments in Tube #1 was the same as difference between the distances migrated by the two fragments in Tube #2. O That the difference between the distances migrated by the two fragments in Tube #1 was much less than the difference between the distances migrated by the two fragments in Tube #2. O It is not possible to estimate what we would expect to see.
How much 340bp insert DNA should be added to a ligation in which 50ng of 4.3kb vector will be used? The desired vector: insert molar ratio needs to be 1:3.
Can you please help with 1c please picture with 1 graph is for question 1a) picture with 4 graphs is for question 1b) 1a) E. coli DNA and binturong DNA are both 50% G-C. If you randomly shear E. coli DNA into 1000 bp fragments and put it through density gradient equilibrium centrifugation, you will find that all the DNA bands at the same place in the gradient, and if you graph the distribution of DNA fragments in the gradient you will get a single peak (see below). If you perform the same experiment with binturong DNA, you will find that a small fraction of the DNA fragments band separately in the gradient (at a different density) and give rise to a small "satellite" peak on a graph of the distribution of DNA fragments in the gradient (see below). Why do these two DNA samples give different results, when they're both 50% G-C? 1b) If you denatured the random 1000 bp fragments of binturong DNA that you produced in question 1a by heating them to 95ºC, and then cooled them down to 60ºC…
1) Prepare the following enzymatic reaction, present it in tabulated form. In a final volume of 30 ul, where buffer 4 (10 ml). How much volume of each reagent would be used and how much of water? Is there any problem? 2) The DNA pol 1 enzyme comes at a concentration of 50,000 U/ml. You have to prepare a 50 ug PCR reaction where you must use 0.05 U/ml reaction. You add 10 ul of PCR buffer, 2 ng of tempered DNA that is at a concentration of 0.5 ng/ul, primers (which are at 200 mM) so that each one remains at a concentration of 200 uM, Mg+2 that is 5 mM (10 X), enzyme and water. Present the table of all the reagents included in the reaction, the volumes of each one in ul. Present where the initial and final concentration of each reagent applies. Assume you have micropipettes for all values.
You have isolated genomic DNA and plasmid DNA from a bacterial culture. Please answer the following questions: 1. What solution did you use to elute DNA from the silica resin column? 2. What is the function of the chaotropic salt in DNA isolation? 3. Why do we add the chaotropic salt for genomic DNA before lysis and for plasmid isolation we add the salts after the lysis step?

SEE MORE QUESTIONS

Recommended textbooks for you

Human Anatomy & Physiology (11th Edition)

Biology

ISBN:

9780134580999

Author:

Elaine N. Marieb, Katja N. Hoehn

Publisher:

PEARSON

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Anatomy & Physiology

Biology

ISBN:

9781259398629

Author:

McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter

Publisher:

Mcgraw Hill Education,

Human Anatomy & Physiology (11th Edition)

Biology

ISBN:

9780134580999

Author:

Elaine N. Marieb, Katja N. Hoehn

Publisher:

PEARSON

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Anatomy & Physiology

Biology

ISBN:

9781259398629

Author:

McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter

Publisher:

Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)

Biology

ISBN:

9780815344322

Author:

Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter

Publisher:

W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology

Biology

ISBN:

9781260159363

Author:

Martin, Terry R., Prentice-craver, Cynthia

Publisher:

McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)

Biology

ISBN:

9781260231700

Author:

Sylvia S. Mader, Michael Windelspecht

Publisher:

McGraw Hill Education

SEE MORE TEXTBOOKS