Match the term to its best definition. molecule with high-energy bond that carries amino acid to translation site part of a gene that gets translated into a protein primary transcript in eukaryotes that needs to be processed single stranded nucleic acid that helps both in transcription and in splicing nucleic acid that makes up 50% of each ribosome sequence of DNA upstream from the gene that binds RNA polymerase before transcription post processing molecule that carries instructions for making a protein from the nucleus to a ribosome in the cytoplasm part of a gene that gets spliced out during pre mRNA processing

Q: DNA MANNMANN B mRNA Transcription Transport to cytoplasm for protein synthesis (translation) Mature…

A: Introduction :- Protein synthesis is the process of creating proteins from amino acids inside live…

Q: Match each of the terms in the left with the best-fitting process in the right column promoter rho…

A: Introduction  Making an RNA copy of a gene's DNA sequence is a process known as transcription in the…

Q: ture MRNA. What are these modifications and what are their significance? Use = following terms to…

A: When introns are eliminated and the mRNA is regarded suitable for translation, eukaryotic pre-mRNA…

Q: Date: Class: Name: Transcription Questions Answer the following questions. 1. What bases are found…

A: DNA is the genetic materials of all most all eukaryotes and prokaryotes. RNA is genetic materials of…

Q: Self-bonded and looped sequences near the end of single poly-ribonucleotide chains control gene…

A: Gene is the sequence of nucleotide that encodes a specific protein.

Q: what are the steps of translation in order based on when they occur? It would be nice if some…

A: Translation is the process by which a protein is synthesized from the information contained in a…

Q: EF-Ts factor regenerates EF-Tu/GDP from EF-Tu/GTP for the next round of elongation cycle in…

A: Introduction The Central Dogma states the formation of RNA from DNA and proteins from RNA.  The…

Q: Addition of a 5'7-methyl guanosine cap to the primary RNA transcript during nuclear processing *…

A: In eukaryotes, the mRNA when transcribed from DNA comes as a pre-mRNA that undergoes the following…

Q: Define . Nonsense codon  as they apply to the genetic code

A: Codons are the triplet of nucleotides present in DNA (deoxyribonucleic acid) or RNA (ribonucleic…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: The sigma subunit of bacterial RNA polymerase ________________________.   is required for the…

A: RNA polymerase "core" from E. coli consists of five subunits: two alpha (α) subunits of 36 kDa, a…

Q: Which mRNA sequences would form a structure that is a cue for transcription termination of some…

A: The ending of termination and the process involved in it are called transcription termination. The…

Q: cleotides                nucleus                      adenine                      cytosine…

A: The process in which DNA forms RNA is called transcription and the process in which RNA forms…

Q: DNA is highly condensed in the chromosomes. What is the sequence of events that enables the…

A: Transcription of a gene refers to production of mRNA using DNA as a template and later using this…

Q: Introns are intervening sequences; what are exons?

A: A gene is an essential unit of heredity and a sequence of nucleotides in DNA or RNA that encodes the…

Q: Which of the following correctly states a similarity between transcription in prokaryotes and…

A: Transcription is a process of synthesizing a messenger ribonucleic acid [m-RNA] from the…

Q: Why is the position of the first AUG after the ribosome-binding site critical?

A: Introduction  The process of transcribing the mRNA into protein is called Translation. There are 3…

Q: An enzyme is needed for the Krebs Cycle.  It will be made following the directions contained in a…

A: In eukaryotes, the genetic information needed for all cellular processes is encoded by genes, which…

Q: A gene is about to be transcribed. Draw a cartoon/ diagram of double stranded DNA that contains this…

A: A gene is the segment of DNA( Deoxyribonucleic acid) , When a gene is transcribed it means the…

Q: For the following characteristics, state whether they are true for the 5' CAP, the Poly-A tail, BOTH…

A: Central dogma is the mechanism by which information of DNA is converted into a product (protein ) by…

Q: Name (Last, First): DNA An RNA Polymerase attaches to the DNA and transcribes the DNA to mRNA…

A: Introduction  Gene expression is the process through which a gene's information is used to create a…

Q: Open reading frames... correspond to introns, which are not read by the ribosome during translation…

A: The genetic material has various components on which the transcriptional and translational machinery…

Q: Classify the following functions or structures as being attributed to proteins, RNA, or RNA-protein…

A: A. Proteins -  Poly A polymerase Release factors (RF1 and RF2) Formation (catalysis) of peptide…

Q: Listed below are steps in the transcription process.  Reorganize the list so the steps in the…

A: Correct steps of Transcription are as follows.   1. General Transcription factors bind TATA box…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: 5’ GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG 3'  From above sequence…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.