Identify the open reading frame in the following DNA sequence, the protein that this gene encodes for, its function, and the source.
GACTATATCCGGCGTATGAAGAAGGTTTCTACGCTTGACCTGTTGTTCGTTGCGATCATGGGTGTTTCGC
CGGCCGCTTTTGCCGCCGACCTGATCGACGTGTCCAAACTCCCCAGCAAGGCTGCCCAGGGCGCGCCCGG
CCCGGTCACCTTGCAAGCCGCGGTCGGCGCTGGCGGTGCCGACGAACTGAAAGCGATCCGCAGCACGACC
CTGCCCAACGGCAAGCAGGTCACCCGCTACGAGCAATTCCACAACGGCGTACGGGTGGTCGGCGAAGCCA
TCACCGAAGTCAAGGGTCCCGGCAAGAGCGTGGCGGCGCAGCGCAGCGGCCATTTCGTCGCCAACATCGC
TGCCGACCTGCCGGGCAGCACCACCGCGGCGGTATCCGCCGAGCAGGTGCTGGCCCAGGCCAAGAGCCTG
AAGGCCCAGGGCCGCAAGACCGAGAATGACAAAGTGGAACTGGTGATCCGCCTGGGCGAGAACAACATCG
CCCAACTGGTCTACAACGTCTCCTACCTGATTCCCGGCGAGGGACTGTCGCGGCCGCATTTCGTCATCGA
CGCCAAGACCGGCGAAGTGCTCGATCAGTGGGAAGGCCTGGCCCACGCCGAGGCGGGCGGCCCCGGCGGC
AACCAGAAGATCGGCAAGTACACCTACGGTAGCGACTACGGTCCGCTGATCGTCAACGACCGCTGCGAGA
TGGACGACGGCAACGTCATCACCGTCGACATGAACAGCAGCACCGACGACAGCAAGACCACGCCGTTCCG
CTTCGCCTGCCCGACCAACACCTACAAGCAGGTCAACGGCGCCTATTCGCCGCTGAACGACGCGCATTTC
TTCGGCGGCGTGGTGTTCAAACTGTACCGGGACTGGTTCGGCACCAGCCCGCTGACCCACAAGCTGTACA
TGAAGGTGCACTACGGGCGCAGCGTGGAGAACGCCTACTGGGACGGCACGGCGATGCTCTTCGGCGACGG
CGCCACCATGTTCTATCCGCTGGTGTCGCTGGACGTGGCGGCCCACGAGGTCAGCCACGGCTTCACCGAG
CAGAACTCCGGGCTGATCTACCGCGGGCAATCAGGCGGAATGAACGAAGCGTTCTCCGACATGGCCGGCG
AGGCTGCCGAGTTCTATATGCGCGGCAAGAACGACTTCCTGATCGGCTACGACATCAAGAAGGGCAGCGG
TGCGCTGCGCTACATGGACCAGCCCAGCCGCGACGGGCGATCCATCGACAACGCGTCGCAGTACTACAAC
GGCATCGACGTGCACCACTCCAGCGGCGTGTACAACCGTGCGTTCTACCTGTTGGCCAATTCGCCGGGCT
GGGATACCCGCAAGGCCTTCGAGGTGTTCGTCGACGCCAACCGCTACTACTGGACCGCCACCAGCAACTA
CAACAGCGGCGCCTGCGGGGTGATTCGCTCGGCGCAGAACCGCAACTACTCGGCGGCTGACGTCACCCGG
GCGTTCAGCACCGTCGGCGTGACCTGCCCGAGCGCGTTGTAA
This question involves using a database. You will use a database for storage and mining of genome sequences. The procedure to identify the gene and the protein that it encodes is as follows:
- How to identify the start site for transcription?
used EXPASY WEBsite translated this DNA sequence, as the IMAGE shown, there are genetic code is translated. i think I am doing wrong?
2. Click on the DNA sequence from the start site of transcription, select all of the sequence, and copy the sequence
Should I copy the letter which is highlitend RED, which is start site, and then past it to BLAST?
Step by step
Solved in 4 steps
I am more confused. how about we start from begining, you post answers on here, and then we go from there?
1. Identify the open reading frame in the following DNA sequence, the protein that this gene encodes for, its function, and the source.
2. "Look carefully at the DNA sequence and identify the start site for transcription"
3.
- Click on the DNA sequence from the start site of transcription, select all of the sequence, and copy the sequence.
- Go to the National Center for
Biotechnology Information (NCBI) website http://www.ncbi.nlm.nih.gov/. Click on BLAST on the right-hand side under “PopularResources .” BLAST is a program that will allow you to find the protein sequence for the DNA sequence (gene) you submit. Next click on blastx (translatednucleotide protein). - Paste the DNA sequence into the box under “Entry Query Sequence.” Scroll down and click BLAST. The search may take a few seconds; the page will keep updating until the search is completed. You do not need to enter any parameters in the boxes before you click BLAST.
- When the search is complete, you will have a figure showing the most homologous results or “sequences producing significant alignments”; and, after that, a list of what these proteins are. Your protein will be the first one on the list. You can click on the accession number or sequence identifier information to bring up more information. You should be able to find the name, function, size (number of amino acids), and source (name of the organism) for the protein. Your answer should include the:amino acid sequence of the protein
- size of the protein: NCBI reference sequence WP_0031138351 CONSISTE 498 amino acids long
- identity of the protein: multispecies, M4 family elastase LasB ( Pseudomonas)
- function of the protein (you may need to do additional online research to find this)
-
bacteria Pseudomonas aeruginosa. Its main function is to break down elastin which is a component of the connect tissue in human. This enzyme helps the bacteria to invade tissues and cause infections by degrading elastin in the host tissue. LasB has also been shown to cleave a variety of other host proteins including immunoglobulins, complement components, and coagulation factors, which further contributes to the pathogenesis of Pseudomonas infections. In addition to its virulence factors, LasB also has industrial and biotechnological applications due to its proteolytic activity.(PubMed)
Identify the open reading frame in the following DNA sequence
Can you show me the step how you get the amino acid sequence?
what is the amino acid squence of the protein?