Guide Questions: 1. What are the four nucleotides bases present in tRNA? Do these bases differ from those found in MRNA? 2. What base in MRNA car only join with the adenine base of RNA? Uracil base of tRNA? 3. What is a codon? What does it represent? 4. What is the role of tRNA In protein synthesis? 5. How does a TRNA molecules carrying its amino acid recognizes which codon to attach? 6. You have iearned that there are stop codon that signals the end of an amino acid chain. Why is it important that a stop codon be part of protein synthesis? 7. A construction worker brings hollow block to bulld a wall. What part of translation resembles the construction worker's job? What do the hollow blocks represent?

Q: 8. A type of gene therapy called RNA interference (RNAI) is being investigated to treat Huntington's…

A: During transcription, the DNA double helix unwinds and the RNA polymerase enzyme reads the template…

Q: How many codons can mutate to become nonsense codons through a single base mutation of the first…

A: The association of 5mC with alternative splicing also challenges the general repressive role…

Q: Exercises: Directions: Complete the following lines for frame shift mutations. Write each codon on…

A: Mutations are changes that occur in the genetic sequence of an organism. These changes alter the…

Q: N mRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Amino Acid Alanine Arginine…

A: Disclaimer: “Since you have posted a question with multiple sub-parts, we will solve first three…

Q: QUESTION 12 The images shown depict the initiation and elongation steps in protein translation. P.…

A:

Q: 1. What is the sequence of the peptide that would result following translation with a ribosome?…

A: The peptide sequence and the mutations occur in codons is given below

Q: deu suoi op MOH

A: Q  1.  DNA is the main genetic material, it is made up of polynucleotide. Mutation can be defined as…

Q: 13' 5' 13' + A represents spliceosome introns and B represents Group II introns A represents Group…

A: Exons can be defined as expressing sequences whereas introns can be defined as intervening…

Q: PROBLEM 19 Four C's occur in a row in the segment of mRNA in Problem 18. What polypeptide would be…

A: 19) Transcription- DNA acts as the genetic material in most of the organisms . DNA stands for the…

Q: rms/d/e/1FAlpQLSf4pNBODhtp6XZ5MLiy4aJP4SwUyY88r3DcxvneABoarLXNAw/viewscore?viewscore=A... AD Tyr Cys…

A: During Protein synthesis messenger RNA contains information in the form of its triplet codons which…

Q: Provide the correct sequence of steps in each process described below. Write the letters in series…

A: Translation involves “decoding” a messenger RNA (mRNA) and using its information to build a…

Q: sequence belo - Indicate the start site for translation by underlining the start codon. - Translate…

A: mRNA sequence 5' GUAGUCAUGCCCGACGCAUUUACGAUUCAGUGACUG 3'. The codons are triplet in nature and the…

Q: Draw a schematic of translation. Include the following: • 5'and 3'of MRNA nucleic acid • N and C of…

A: Translation is a process of making polypeptide chain, that is protein synthesis. Translation takes…

Q: What molecule/feature ensures that the correct amino acid is added with reading of a specific codon…

A: The anticodon is a crucial component of transfer RNA (tRNA) molecules and plays a central role in…

Q: 2. Use the MRNA sequence to find the DNA sequence and the amino acid sequence. DNA MRNA-…

A: Nucleic acids are present inside the nucleus to store and pass genetic information and thus control…

Q: a. The right side shows the ribosome with an empty A site aligned with the codon 5’UAU 3’. The next…

A: When the DNA that is already transcribed to RNA inside the cell ribosomes helps this mRNA to…

Q: Q8. Protein synthesis is carried out by the processes of transcription and translation. A short…

A: The transcription is the process by which RNA is produced from the DNA template and the translation…

Q: Which amino acid would bind if the mRNA read.... AGG? Ala (A) Ser (S) G A Lys (K) Asp (D) U ← Asn…

A: Once mRNA is produced, by transcribing and processing the information contained in the nucleotide…

Q: Describe the function of each of the following Shortly. a. Amino-acyl tRNA synthetase b. E…

A: a. Amino-acyl tRNA synthetase The tRNAs are activated or charged with the aminoacid in the two step…

Q: The IRNA that was in the P site moves into the A site C. The tRNA that was in the A site moves to…

A: The process of protein synthesis is called translation. In this process transfer RNA, messenger RNA…

Q: QUESTION 2 Which of the following pairs of tRNA antiqodons is most likely to be used in translation…

A: Polypeptide synthesis relies on a constant supply of tRNAs that are charged with 20 amino acids.…

Q: Answer the ff. DNA fragment A is 3' AGC CCG CTC CGA GGC TAA AAG CGT 5' A. is the 3rd amino…

A: Transcription: The process of making mRNA from DNA is called Transcription. mRNA strand Synthesised…

Q: how is the growing polypeptide released from the ribosomal assembly?

A: A gene is a DNA-based functional heredity unit that delivers instructions for the production of RNA…

Q: TRNAS contain the anticodon that interacts with [Select ] [Select] TRNAS MRNAS pre-RNAS

A: Translation is the mechanism by which ribosomes in the cytoplasm or endoplasmic reticulum create…

Q: Need help Below is a strand of mRNA with three codons listed on the strand. Imagine the mRNA strand…

A: Translation is a process of reading of mRNA to form proteins. It requires several components ljke…

Q: 1. A tRNA has the anticodon sequence: 5'-IGC- 3'. which codon will not decipher with this tRNA? a)…

A:

Q: 2. What do you predict would happen if you created-a RNA with an anticodon of 5'-CAA-3' that is…

A: The translation of the proteins takes place as the mRNA having the codons are fitting into the…

Q: which amino acid would be carried by a tRNA with the anti-codon 5AAG3?

A: Each tRNA molecule has an anticodon for the amino acid it carries. An anticodon is a sequence of 3…

Q: 5. There is more than one codon and tRNA for most amino acids. The L-shaped molecule binds a…

A: Charged tRNA match an mRNA codon with the amino acid it codes. tRNA brings amino acids to…

Q: Question : The peptide bond : (Indicate the right answer) : A- Is a hydrophobic bond. B- Is formed…

A: The peptide bond is also similar to an amide bond that helps to join two amino acids and make a…

Q: Choose the correct option for following three mcqs 10.Which of the following statements regarding…

A: The genes are the hereditary unit of an organism which are passed on from the parental generation to…

Q: PROBLEM 20 UAA is a stop codon. Why does the UAA sequence in mRNA in Problem 18 not cause pro- tein…

A: The enzyme RNA polymerase utilizes the DNA as a template to generate pre-mRNA transcripts during…

Q: 1. Ribosomes are “ribonucleoprotein particles” in that they are composed mostly of rRNA with some…

A: All live cells require ribonucleoprotein particles, which include both RNA and proteins. They…

Q: QUESTION 8 What is the function of the Kozak sequence in eukaryotes? O a. it is recognized by…

A: Kozak sequence is a nucleotide sequence in the mRNA that serves as the site for the initiation of…

Q: Practice question 1D) In the boxes on the image, label the N and C termini of the çsRu protein. .…

A: The C terminal of protein has a carboxyl group free while the N terminal of a protein has one amine…

Q: GQ9

A: The question is asking why C. elegans, a tiny worm, which has about the same number of genes as…

Q: Assignment 9: Transcribing and Translating a Protein Activity  5.4.1 Synthesis of a Protein: A…

A: 1. Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence…

Q: 18. Amino acids at the N-terminal end of eukaryotic polypeptides that contain information required…

A:

Q: Match the molecule with its correct description

A: mRNA - Carries a copy of the genetic "message". tRNA  -   Has anticodons Aminoacyl tRNA synthetase -…

Q: 2. Assume 250 base pairs to be responsible for a particular portion of mRNA molecule. What is the…

A: bp = base pair—one bp corresponds to approximately 3.4 Å   of length along the strand 1angstrom (Å),…

Q: Antibiotics that selectively inhibit bacterial growth exploit differences between bacterial and…

A: Antibiotic action that selectively functions on inhibition of cellular activities of the bacterial…

Q: please help with this

A:

Q: 39) Use the following information to answer the question. A part of an MRNA molecule with the…

A: Introduction-  The genetic information of living organisms is stored in the cell in the form of DNA.…

Q: ) Amino acid sequence of a heptapeptide gave the following information Asp, leu, lys, ,met, phe and…

A: Introduction Amino acids are the building blocks of proteins. The building blocks of life are amino…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.