Given the following mRNA sequence: 5' GCCCAUGUGGCGCGAGUGAUUUAA 3' 1) Use the genetic code table provided to translate the open reading frame. 2) What happens when the ribosome reaches the last codon? 3) What affect would the following mutation have on the open reading frame: 5' GCCCAGGUGGCGCGAGØGAUUUAA 3' 4) What affect would the following mutation have on the open reading frame: 5' GCCCAUGUGGCGCGAGUGCUUUAA 3' 5) What is the term for the 5' end of this mRNA sequence?

Q: Yeast have 8 similar tRNA genes with the anticodon 5’-GUA. A researcher mutates one of these genes…

A: Tranafer RNA helps in transporting amino acid as per the instructions given by messenger RNA during…

Q: Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change…

A: Mutations are the abrupt changes in the DNA sequences due to wrong reading of the DNA polymerase…

Q: Examine the following mRNA transcripts: Wild type: 5' CACUGAUGCACGGAUCAU 3' Mutant: 5'…

A:

Q: AAUCCCAAU ITTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG-W' JAATCCCAATCCCAATCCCAA-X' Figure 3 (i) Label the…

A: Telomeres are the structures(caps) that are present at the end of the chromosomes, their fhbction is…

Q: One of the codons in mRNA that specifies the amino acid phenylalanine is UUC. What is the anticodon…

A: Answer: Introduction: An anticodon means the three-base arrangement, paired with a specific amino…

Q: What is an Okazaki fragment, and how are they later “glued” together?

A: In the semi discontinuous mode of replication when DNA unwinds , one strand is synthesized…

Q: Using a table that shows which codon represents which amino acid determine the following:   A)…

A: The three nucleotide sequence either DNA or RNA is called codons.During protein synthesis, it codes…

Q: Describe the anticodon of a single tRNA that could recognize the codons 5′–AAC–3′ and 5′–AAU–3′.…

A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…

Q: Using the Genetic Code Table in Figure 1.3, what is the proper sequence of amino acids in the…

A: DNA ( Deoxyribonucleic acid ) is two stranded ladder like structure which act as genetic material in…

Q: 2a) Suppose you have a gene in which a single base substitution has created the nonsense mutation…

A: DNA(deoxyribonucleic acid) is the genetic material in all the organisms except few viruses. The…

Q: In eukaryotes, RNA polymerase II produces capped RNA during transcription. (i) Draw the chemical…

A: "DNA plays a crucial role in the process of protein synthesis. The information stored in DNA is used…

Q: Yeast have 8 similar tRNA genes with the anticodon 5'-GUA. A researcher mutates one of these genes…

A: Original Codon Decoded: The complementary codon to the anticodon was first decoded by the tRNA…

Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…

A: Gene expression is a process by which the genes are turned on to form RNA and proteins. This is seen…

Q: Many uridine molecules are inserted into some mitochondrial mRNAs in trypanosomes. The uridine…

A: Trypanosomes are single-celled parasitic protozoa. This parasite causes sleeping sickness in humans.…

Q: a) Two of the following three mRNA sequences code for the same protein.  Delete the sequence which…

A: Translation is defined as the process where the nucleotide sequence in the mRNA is translated to…

Q: Phenylalanine (Phe) is encoded by either UUU or UUC, while Tyrosine (Tyr) is encoded only by UAC and…

A: Given  Phenylalanine (Phe) is encoded by either UUU or UUC, while Tyrosine (Tyr) is encoded only by…

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: Part A The bacterial gene little protein (lilP) makes a small protein of 11 animo acids (AA) in…

A: Introduction :  The translated form of the DNA sequence is the amino acid sequence. The DNA sequence…

Q: None

A: a) The informational strand (also known as the coding strand) of DNA is complementary to the…

Q: What is the primary difference betwee class I and class II aminoacyl-tRNA synthetases.   a. Class…

A: An enzyme that synthesizes tRNAs by amino acid polymerization is called an aminoacyl-tRNA synthetase…

Q: The antibiotic paromomycin binds to a ribosome and induces the same conformational changes in 16S…

A: Ribosomes are complex molecules that are composed of ribosomal RNA molecules where photosynthesis…

Q: How many open reading frames are present in the following mRNA sequence? You may find the codon…

A: An open reading frame in molecular genetics describes the part of your reading frame that has the…

Q: give the amino acids specified by the following bacterial mRNA sequences. a. 5′…

A: In the given question, the bacterial mRNA sequence is given for which we have to find the amino…

Q: 26) The accompanying drawing represents simultaneous transcription and translation in E. coli. The…

A: Protein synthesis takes place in two stages, namely, transcription and translation. Transcription is…

Q: Consider the following tRNAs, where the numbered forms represent the amino acids associated with…

A: Transcription is the process  in which mRNA (messenger RNA ) is made from DNA which further…

Q: Given the following mRNA sequence, write the peptide sequence that will result from protein…

A: mRNA stands for messenger RNA( Ribonucleic acid).  Protein translation is a process of making…

Q: For the below sequence, where the +1 site is in bold underline and the +10 and -10 sites are also…

A: Option 1 i.e. 5' AUA 3' is the correct answer.

Q: For this double stranded DNA: 3’-AGGTCCAGTCTTCGGCGGATGATCGGGCCAACCCCCGTAACTGGTCACCGGAATGCC-5’…

A: 4 codes are used by the DNA that areAdenine (A), Thymine (T),  Guanine (G), Cytosine (C)RNA also…

Q: What will be the overall anti-codon sequence in tRNA for this mRNA?…

A: Proteins are synthesized from DNA in two step process. These two processes are transcription and…

Q: The following polynucleotide was synthesized and used as a template forpeptide synthesis in a…

A: The consecutive three nucleotides together form one codon. Each codon encodes for a particular amino…

Q: By comparing Figures 8-16 and 8-17 with Figure 8-18,speculate what features of RNA permit…

A: The features of RNA that permit self-splicing (that is, in the absence of proteins)is that RNA is…

Q: In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood…

A: When referring to DNA transcription, the coding strand is the DNA strand whose base sequence is…

Q: According to wobble rules, what codons should be recognized by the follow- ing anticodons? What…

A: Wobble pairing was defined as the base-pairing with two nucleotides that do not follow Watson-Crick…

Proteins

We generally tend to think of proteins only from a dietary lens, as a component of what we eat. However, they are among the most important and abundant organic macromolecules in the human body, with diverse structures and functions. Every cell contains thousands and thousands of proteins, each with specific functions. Some help in the formation of cellular membrane or walls, some help the cell to move, others act as messages or signals and flow seamlessly from one cell to another, carrying information.  

Protein Expression

The method by which living organisms synthesize proteins and further modify and regulate them is called protein expression. Protein expression plays a significant role in several types of research and is highly utilized in molecular biology, biochemistry, and protein research laboratories.