FIGURE 19.16 Direct repair of dam- aged bases in DNA. (a) The repair of thymine dimers by photolyase. (b) The repair of methylguanine by the transfer of the methyl group to Thymine dimer CH3 SH 06-Methylguanine CH2 ONLINE ANIMATION Н. CH3 Нас. N- н- Н Н N. `NH2 Alkyltransferase alkyltransferase. CONCEPT CHECK: Which of these DNA backbone Alkyltransferase catalyzes the removal of the methyl group onto itself. repair systems is particularly valuable to plants? DNA DNA photolyase cleaves the 2 backbone bonds between the thymine dimer. CH3 Guanine На 'N' CHз Нас. -- н CH2 н Н `NH2 The normal structure of the 2 thymines is restored. The normal structure of guanine is restored. (a) Direct repair of a thymine dimer (b) Direct repair of a methylated base O=

FIGURE 19.16 Direct repair of dam- aged bases in DNA. (a) The repair of thymine dimers by photolyase. (b) The repair of methylguanine by the transfer of the methyl group to Thymine dimer CH3 SH 06-Methylguanine CH2 ONLINE ANIMATION Н. CH3 Нас. N- н- Н Н N. `NH2 Alkyltransferase alkyltransferase. CONCEPT CHECK: Which of these DNA backbone Alkyltransferase catalyzes the removal of the methyl group onto itself. repair systems is particularly valuable to plants? DNA DNA photolyase cleaves the 2 backbone bonds between the thymine dimer. CH3 Guanine На 'N' CHз Нас. -- н CH2 н Н `NH2 The normal structure of the 2 thymines is restored. The normal structure of guanine is restored. (a) Direct repair of a thymine dimer (b) Direct repair of a methylated base O=

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

What type of mutation is shown in the diagram? Why do you think this type of mutation is referred to by this term?
The joining of a new nucleotide to a growing strand during DNA synthesis leads to the formation of a phosphoester bond and involves O a nucleophilic attack of the terminal P atom of the growing strand on the electrophilic 3-0 atom of the growing strand O a nucleophilic attack of the terminal 3'-0 atom of the growing strand on the electrophilic P atom of the incoming nucleotide O an electrophilic attack of the terminal 3'-O atom of the growing strand on the nucleophilic P atom of the incoming nucleotide an electrophilic attack of the terminal Patom of the growing strand on the nucleophilic 3-O atom of the growing strand
Part b plz
If a given double stranded DNA undergoes enzymatic hydrolysis targeting only the "a" side in the phosphodiester bond, what are the consequent nucleotide products of the hydrolysis of the 2 strands? (Please write the answers using only the letters corresponding to the bases with either the p or OH beside it to indicate the phosphate and OH groups respectively.) Sequence in one strand: TCGATCAG Use the editor to format your answer
Why is it unfavorable for RNA molecules to adopt a double-helix structure similar to B-DNA? Because it is entropically unfavorable Because that would cause a steric clash between the sugars and nucleobases Because that would cause a steric clash between the 2' OHs of the sugars and the phosphates Because uracil can't form hydrogen bonds with any other nucleobases
32. The molecule above is called HO 08-0 OH OH and it can be found in A) 3'-deoxyribose-5'-phosphate; RNA B) 2'-deoxyribose-5'-phosphate; RNA 3'-deoxyribose-5'-phosphate; DNA D) 2'-deoxyribose-5'-phosphate; DNA 33. The chromosomes we typically con in im OH
On the 4 diagrams below show the four different ways (which strands are cut and where for each Holliday junction) that the Holliday junction structures can be resolved and denote whether this leads to a recombination event or not." 3 1 IT |? 3 ||| |AL||T|||c| |||| 4 5 6 TIT!!T?L|| ?|||?| |||| TIT|| |AL||T|||C| |||| 4 5 6 3 3' 3 T?L|| ?| ||?| |!!! || |A|||T| |jcj ||| 4 5 6 TI T?L|| ?|||?T ||| jT|| |ALİ|Ti||c| ||| 4 5 6
3. For each of the following characteristics, list all of the bases (A, B, C, or D) to which they apply. (a) A signal that identifies a parental DNA strand in the MutH,L,S mismatch correction system (b) Most likely to be involved in cyclobutane dimer formation after A B D HN-CH3 o-CH3 NH2 CH3 CH3 HN HN ultraviolet irradiation of DNA H,N (c) A methylated base found immediately to the 5' side of dGMP residues in eukaryotic DNA
Correct order ib which the following enzynes would operate to fix a damaged nucleotide in a human gene. a) nuclease, DNA polymerase, RNA primase b) helicase, DNA polymerase, DNA ligase c) DNA ligase, nuclease, helicase d) nuclease, DNA polymerase, DNA ligase
Explain why the absorption of UV light by double-stranded DNA increases (the hyperchromic effect) when the DNA is denatured.
What is the melting temp. of the following double-stranded DNA fragment TCAAAAATCGAATATTTGCTTATCTA AGTTTTTAGCTTATAAACGAATAGAT
6. H₂C HO O O T "N Which of the following dinucleotides can be methylated by DNA methyltransferase? NH₂ NH₂ N N NH NH C N NH N NH "N topol NH₂ Dofo HO G 01-07 HO "NH₂ NH₂ N NH, QP-C NH₂ Joy HO HO НО B C D 7. Explain the effect of the acetylation status of histones on chromatin structure and gene expression. Your answer should include the terms "heterochromatin", "euchromatin", "transcriptionally active" and "transcriptionally inactive" Dofo HO