FIGURE 19.16 Direct repair of dam- aged bases in DNA. (a) The repair of thymine dimers by photolyase. (b) The repair of methylguanine by the transfer of the methyl group to Thymine dimer CH3 SH 06-Methylguanine CH2 ONLINE ANIMATION Н. CH3 Нас. N- н- Н Н N. `NH2 Alkyltransferase alkyltransferase. CONCEPT CHECK: Which of these DNA backbone Alkyltransferase catalyzes the removal of the methyl group onto itself. repair systems is particularly valuable to plants? DNA DNA photolyase cleaves the 2 backbone bonds between the thymine dimer. CH3 Guanine На 'N' CHз Нас. -- н CH2 н Н `NH2 The normal structure of the 2 thymines is restored. The normal structure of guanine is restored. (a) Direct repair of a thymine dimer (b) Direct repair of a methylated base O=

FIGURE 19.16 Direct repair of dam- aged bases in DNA. (a) The repair of thymine dimers by photolyase. (b) The repair of methylguanine by the transfer of the methyl group to Thymine dimer CH3 SH 06-Methylguanine CH2 ONLINE ANIMATION Н. CH3 Нас. N- н- Н Н N. `NH2 Alkyltransferase alkyltransferase. CONCEPT CHECK: Which of these DNA backbone Alkyltransferase catalyzes the removal of the methyl group onto itself. repair systems is particularly valuable to plants? DNA DNA photolyase cleaves the 2 backbone bonds between the thymine dimer. CH3 Guanine На 'N' CHз Нас. -- н CH2 н Н `NH2 The normal structure of the 2 thymines is restored. The normal structure of guanine is restored. (a) Direct repair of a thymine dimer (b) Direct repair of a methylated base O=

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

The joining of a new nucleotide to a growing strand during DNA synthesis leads to the formation of a phosphoester bond and involves O a nucleophilic attack of the terminal P atom of the growing strand on the electrophilic 3-0 atom of the growing strand O a nucleophilic attack of the terminal 3'-0 atom of the growing strand on the electrophilic P atom of the incoming nucleotide O an electrophilic attack of the terminal 3'-O atom of the growing strand on the nucleophilic P atom of the incoming nucleotide an electrophilic attack of the terminal Patom of the growing strand on the nucleophilic 3-O atom of the growing strand
ive put the instructions already. please answer
Which DNA repair systems you think might be capable of repairing a situation where T is in one strand and G is in the complementary strand? Explain dramatically.
Consider normal B-form DNA. It forms a regular antiparallel double-helical structure with Watson-Crick base-pairing mediated through hydrogen bonding. The base pairs all stack upon one another, with 3.4 Å spacing between them. DNA strands having a complementary sequence will spontaneously form a double-helix in an aqueous solution. In terms of energy, what primarily drives helix formation? O Positive Entropy from base stacking van der Waals interactions O Hoogsteen interactions Positive Enthalpy from Hydrogen Bonding between GC and AT pairs Negative Enthalpy from Hydrogen Bonding between GC and AT pairs O Negative Entropy from base stacking
Given the structures of the nitrogenous bases shown in the picture, draw the structure of a part of DNA with the sequence: 5'-GTTCA-3'.
Analogs of nucleotides are often used in studies of DNA. An analog is a modification of one of the normal bases that can be incorporated into DNA via replication and can later be detected for analysis. The thymidine analog 5-ethynyl-2′-deoxyuridine (EdU) is widely used in the laboratory for these types of experiments. However, EdU is toxic to cells, and inclusion of EdU in growth medium eventually causes cell death, unlike other thymidine analogs. Recently, a research team examined if cells recognized EdU as damage to the DNA and if the cells used the nucleotide excision repair (NER) systems to fix the DNA (see figure A). Human cells cultured in the lab were treated for 24 hours with either EdU or another thymidine analog, BrdU (blue circles in the figure). The cells were then exposed to UV light where damage would occur (red triangles in the figure). After 1 h of repair in the presence of the analog, the cells were lysed and excision products were separated from cells. An…
On the 4 diagrams below show the four different ways (which strands are cut and where for each Holliday junction) that the Holliday junction structures can be resolved and denote whether this leads to a recombination event or not." 3 1 IT |? 3 ||| |AL||T|||c| |||| 4 5 6 TIT!!T?L|| ?|||?| |||| TIT|| |AL||T|||C| |||| 4 5 6 3 3' 3 T?L|| ?| ||?| |!!! || |A|||T| |jcj ||| 4 5 6 TI T?L|| ?|||?T ||| jT|| |ALİ|Ti||c| ||| 4 5 6
Cytosine can be deaminated to form Uracil What type of mutation is this classified as? Discuss what happens to the base-pairing properties from switching from C to U? When U is replicated in two rounds of synthesis, what substitution does this result in? Before Uracil alters the DNA during replication, what repair system can be used to correct this error? Describe how this type of DNA repair works?
Explain why the absorption of UV light by double-stranded DNA increases (the hyperchromic effect) when the DNA is denatured.
What is the melting temp. of the following double-stranded DNA fragment TCAAAAATCGAATATTTGCTTATCTA AGTTTTTAGCTTATAAACGAATAGAT
( please provide answer step by step with diagram you must give diagram plz write in your own language , dont copy from internet or book.
DNA polymerases cannot initiate DNA synthesis without a primer, a section of nucleic acid having a free 3' end that forms a double helix with the template. How is this primer formed?