Explain the role of boundary elements in the DNA. If you were to use gene editing technology to remove the IR-L boundary element, what would happen to the chromatin structure in this area? Why? Euchromatin mat1 Euchromatin Boundary Boundary Heterochromatin 2.5 kb IR-L mat2P mat3M IR-R cenH 66...

Explain the role of boundary elements in the DNA. If you were to use gene editing technology to remove the IR-L boundary element, what would happen to the chromatin structure in this area? Why? Euchromatin mat1 Euchromatin Boundary Boundary Heterochromatin 2.5 kb IR-L mat2P mat3M IR-R cenH 66...

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Related questions

Q: Nucleosomes are the ball-like structures around which the double helix winds. What proteins make up…

Q: A chromosome initially has the following segments:A B • C D E F G Draw the chromosome, identifying…

A: The chromosomes have two arms that are called the short and long arm. The short arm is also referred…

Q: The data below are from a DNAse-Seq experiment of chromosome 22. DNAse-seq is another method for…

A: The DNAse-Seq experiment is a method used to analyze chromatin organization by digesting regions of…

Q: In the diagram below, where does Mediator attach? (There are two correct answers. Canvas will not…

A: In eukaryotes, a multiprotein complex called a mediator acts as a coactivator of transcription. As…

Q: In the image below, which arrow denotes the protein that forms the nested DNA loops in chromatin?…

A: Linker histones (H1 and its variations) or HMG proteins bind lengths of DNA that connect adjacent…

Q: sketch of ONE complete Nephron in the kidney and label to show the blood flow

A: The main excretory organ in humans is kidney. Each individual ordinarily has two kidneys located on…

Q: We seem to know more about the structure of eukaryotic chromosomal DNA than bacterial DNA. Discuss…

A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…

Q: 6.) How does RNAi maintain the heterochromatin at the centromeres of chromosomes?

A: Heterochromatin is a form of DNA (deoxyribonucleic acid) that is dense or closely packed. It varies…

Q: 8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for…

A: The process in which the DNA is converted into mRNA is called transcription and in which mRNA is…

Q: So, if the answer is correct, enter N/A in the short answer below. If the answer is false, correct…

A: Transcription is the process of copying the genetic information from the DNA into RNA and it is then…

Q: What is a puff on a polytene chromosome? a highly condensed region of DNA a region containing the…

A: Polytene chromosomes are found in the salivary glands of the insect like in Drosophila and other…

Q: Consult Figure 2. Would you consider this figure to be depicting euchromatin, or heterochromatin,…

A: Chromatin exists as euchromatin or heterochromatin. Euchromatin are loosely bound,less condensed,…

Q: If a person is lacking a gene that codes for a protein involved in nucleotide excision repair, then…

A: DNA can experience a variety of chemical reactions, as in any other molecule. However, since DNA is…

Q: Why do we say replication and transcription is highly stochastic? There are just 4 types of…

A: The process of DNA replication or transcription, we have noticed that there are many steps involved,…

Q: If telomeres are normally shortened after each round of replication in somatic cells (see Chapter…

A: Cloning is the creation of identical biological entities for therapeutic and reproduction. It is…

Q: Below is a portion of an exon from a gene that encodes protein Y in the genome of the plant…

A: Ans 1 : Yes, there is a mutation in third codon when counting from 5/ to 3/ on template strand in…

Q: A recombinant protein corresponding to 52 repeats of the peptide sequence YSPTSPS was covalently…

A: The peptide sequence YSPTSPS is a known phosphorylation site that corresponds to the heptad repeat…

Q: onsider the following segment of DNA, which is part of a linear chromosome: LEFT…

A: Answer. Transcription is a process of the formation of transcript (RNA). It takes place by the…

Q: A plant geneticist was examining the inversion mutation XI 501 in barley where a segment of DNA is…

A: Any alteration occurring in the DNA sequence of an organism is known as mutation.

Q: Ac

A: The fundamental physical and functional unit of heredity is the gene. DNA is the material that makes…

Q: Eukaryotic life also uses chromatin modifications to turn transcripts on and off. We talked about…

A: Chromosomes are the thread-like structures that consists of DNA in tightly packed manner within the…

Q: a. What DNA sequences are found at the telomeresof human chromosomes?b. What functions do the two…

A: The deoxyribonucleic acid (DNA) is the hereditary material that transmits the genetic information…

Q: Consider the figure beow, which depicts chromatin within the neucleus of a eukaryotic cell. nucleus…

A: Topologically associating domain (TAD) also called chromosomal interacting domains in bacteria. They…

Q: Consider the following segment of DNA, which is part of a linear chromosome: LEFT…

A: DNA replication is the process by which the DNA is copied in the cell to make up more number of DNA…

Q: Consider Figure 7, which illustrates a point in DNA synthesis for one end of a chromosome, after the…

A: DNA synthesis or DNA replication is a process where parental DNA makes two identical copies of…

Q: 5. a. About how many molecules of histone H2A wouldbe required in a typical human cell just after…

A: The cell cycle is also referred to as the cell division cycle. This cycle refers to a series of…

Q: Some chromatin remodeling factors use energy from ATP hydrolysis to slide nucleosomes.shifting…

A: Chromatin remodeling can significantly alter gene expression. It is studied under the domain of…

Q: You are interested in studying a gene called pumper that is important for heart function. The pumper…

A: Chromatin is the region containing gene. Some genes are in open state and some genes are in closed…

Q: 8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for…

A: The process in which the DNA is converted into mRNA is called transcription and in which mRNA is…

Q: 2ith the diagram provided please write the polypeptide. sequence obtained from the translation of…

A: INTRODUCTION Translation is the process of translating the sequence of a messenger RNA (mRNA)…

Q: fill in the blank When the cell goes from M to GI, the number of nucleosomes on this stretch of DNA…

A: The cell cycle is a cyclic process where new cells are formed, increase in size, and enters…

Question

Explain the role of boundary elements in the DNA. If you were to use gene editing technology to
remove the IR-L boundary element, what would happen to the chromatin structure in this area?
Why?
Euchromatin
mat1
Euchromatin
Boundary
Boundary
Heterochromatin
2.5 kb
IR-L mat2P
mat3M IR-R
cenH
66...

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

Euchromatin refers to regions of DNA that are loosely packed to increase the efficiency of transcription. Which of the following would you expect to find in a region of euchromatin? O A. more thymines O B. fewer thymines C. more histones O D. fewer histones wered MacBook 20 F3 000 000 F4 II F8 F2 F5 F6 F7 @ $ % & 2 4 5 6 8. %# 3
What is a contig?
Which of the following DNA sequences will travel the shortest amount down a gel? A ATTGCAGGCCCT GCGATGCTAGC TTACGATCGGAA D GCTACTGATС
Parts a-e
A sample of chromatin was partially digested by the enzyme Staphylococcal nuclease. The DNA fragments from this digestion were purified and resolved on a polyacrylamide gel. A set of DNA restriction fragments was used as markers. Distances of migration (d) are given below in cm. From these data, estimate the nucleosome repeat distance in the chromatin.
Asap
Place the following eukaryotic DNA structures in order of thickness, smallest to largest heterochromatin double helix nucleosomes 30 nm chromatin fibre looped domain
Genes are not always active in cells. The cell has evolved to edit its chromatin state in accord with the energy needs of the cell and organism. What are these two kinds of chromatin called and how does chromatin modeling work in cells? Name four of the known families of chromatin remodeling complexes enzyme complexes that act directly on DNA to alter nucleosome composition in transcribed regions.
2. Consider the following DNA molecule. Assume this is the DNA sequence of the entire chromosomes. Assume there are no introns. 3' AATTAGCAGATGCATGATGCAATTACTAGCATGTAAGTA 5' 5' TПААТСGTТСТАСGTACTАCGTTAATGATCGTACATTCAT 3' Based on your knowledge of open reading frames, list the amino acid sequences of the possible protein or proteins that could be produced from this DNA sequence. You may use any codon table of your liking to complete the work. a. b. Suppose there was a sister chromatid generated from the chromosome sequence shown above. What would be its DNA sequence (provide the sequence in the space below. Be sure to identify the 5' and 3'ends)?
The recombination process below occurs when two recombination occurs between two different alleles, but only only one of the alleles is perpetuated in the final product. This process is called [x]?
1st choices: promoter, 3’ UTR, exon 1, 5’UTR 2nd: Met, Lys, Arg, Leu, lle 3rd: GCC, AUC, UGA, GAA
If a section of a chromosome is heavily methylated, which of the following is likely to be true? Group of answer choices That portion of the chromosome is transcriptionally active That portion of the chromosome consists of euchromatin That portion of the chromosome is transcriptionally quiet RNA polymerase will have easy access to the DNA in that region