1.Draw the sequence of events that lead to kinesin heads moving along aprotofilament of a microtubule. Start with the leading head( label #1) boundto the protofilament but not associated with a nucleotide and the lagginghead(label #2) loosely associated with the protofilament and bound to ADPRepresent the events that occur that lead to head #2 advancing in front ofhead #1. Your drawing should accurately represent the conformationalchanges in the neck linker and type of nucleotide bound to kinesin. Label thetubulin dimers ( alpha, beta), neck linkers, coiled coil , and the polarity of theprotofilament( plus end , minus end). Use arrows to indicate direction ofmovement.

Microtubules is part of Cytoskeleton. It is made up of single protein tubulin. Cytoskeleton is…

Answered: Draw the sequence of events that lead…

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Genetic testing of a 29-month-old boy shows a mutation in the Phe residue at position 508 in the cystic fibrosis transmembrane conductance regulator (CFTCR) gene. Cultured skin fibroblasts from the boy contain an abnormal form of CFTCR protein bound to ubiquitin. Which of the following structures is the most likely site of elimination of these abnormal proteins in this patient? A) Endoplasmic reticulum B) Endosome C) Golgi complex D) Lysosome E) Proteasome
Which of the following concerning progeria are false? Choose all that apply. 1. Normally, Zmpste24 cuts pre-lamin to remove 50 amino acids 2. Exon 11 in LaminA codes for the binding site of Zmpste24 3. Progerin does not associate with the nuclear membrane due in part to the extra 18 amino acids it contains 4. The silent mutation known to cause Progeria results in a splicing defect affecting formation of mature LaminA
please fill in the blank When the cell goes from M to GI, the number of nucleosomes on this stretch of DNA should ------, and the width of the chromatin fiber should -------. Please select one Newly made lamins should ( single peptide = SP), or (nuclear localization = NLS) or (Transit peptide =TP) or ( Transmembrane domain) or ( SP and NLS) or ( SP or TP) or (transcription activating domain) or ( None of these)
The BSA precursor protein is 607 amino acids long and has a molecular weight 69.324 kDa. If a eukaryotic ribosome can synthesize an amino acid chain at 2 amino acids/sec, how many seconds would it take for 107 ribosomes to produce 1 pg of BSA precursor?
You are studying a cytoskeletal accessory protein, AB2. You believe it is involved in receptor-mediated endocytosis allowing for the entry of a novel virus, SARS-CoV X, into the host cell. To confirm that AB2 is required for viral entry, you engineer an AB2 protein containing an N-terminal hydrophobic signal sequence and a C-terminal KDEL sequence (AB2-SSKDEL) and express it in human epithelial airway cells. You compare cells expressing wild-type (WT) AB2 (lacking the signal sequence and KDEL sequence) with cells expressing AB2-SSKDEL. You are looking at the entry of a GFP (green) virus into cells. If AB2 is required for viral entry, via receptor-mediated endocytosis, what results would you expect to see in terms of viral entry? A. WT AB2 - Green ER AB2-SSKDEL - No green ER B. WT AB2-NO green cells AB2-SSKDEL - Many green cells OC. WT AB2 - Many green cells AB2-SSKDEL - NO green cells D.WT AB2 - Green nuclei AB2-SSKDEL - No green nuclei
Describe how an Rna molecule is translated into a protein at the ribosome In 4 simple bullet points please
Given the following sequence of a coding DNA strand: AGTTGCGCATGCCAGAGAGGTTCGAGTGCACATAACTTGAG The template DNA strand will have the following sequence written in the conventional manner with no orientation indicators: The corresponding tRNA sequence written in the conventional manner with no orientation indicators will be: After translation was complete, the resulting polypeptide underwent post-translational modification wherein the N-terminal Met residue was removed from the polypeptide. Using one-letter abbreviations, the sequence of the resulting polypeptide is
Where do you predict the N- and C-termini are located for Max? Match the words in the left column to the appropriate blanks in the sentences on the right. electrostatic dispersion negative C-terminus positive positively negatively N-terminus The Reset Help is interacting with the DNA. The first reason for this is because the a-amino group is positively charged and will interact favorably with the of the charge on the phosphodiester backbone of the DNA. The second reason is that this orientation also situates the partial end of the helical macrodipole for favorable interactions with the charged phosphodiester backbone of the DNA
Transport of histidine into a bacterial cell was measured at several different histidine concentrations, see table below. Based on these data, is histidine uptake facilitated by a carrier or channel protein? a b Histidine (uM) 2.5 7 16 31 72 с Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. A carrier protein because it becomes saturated. A carrier protein because it does not become saturated. A channel protein because it becomes saturated. Transport (uM/min) d A channel protein because it does not become saturated. 42.5 119 240 490 1000 X Your answer
Give correct typing answer with explanation and conclusion You found a mutation in a gene that causes a reading frame shift early in its mRNA. This introduces an early stop codon that results in a complete lack of functional protein. Which of the following is the most likely cause of this mutation? A single base deletion in an exon of the gene A 6 base deletion in an intron the gene A 3 base insertion in an exon of the gene A 4 base insertion in an intron of the gene
The diagram shown represents the coding strand of the myosin gene. Mutations in myosin can lead to muscle defects during development. Using what you know about how mutations can affect transcriptional and post-transcriptional regulation, match the results shown on the Northern (mature mRNA) to the mutations shown. The N lane shows the size and amount expected for non-mutated myosin mRNA. All samples were loaded at the top (-) side of the gel. Part 1. Which lane or lanes on the gel could be the result of mutation A? --4 ТАТАА AUG UAA Only known regulatory region TSS Mutation B: Mutation C. A: 5-base 20 nucleotides 3 nucleotides deletion deleted changed N 1 2 3 4 5
Please use Transferrin receptor as an example of the protein whose pathway is being traced. If it is easier or possible, can there be a labeled drawing to explain.

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781305961135

Author:

Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Fundamentals of General, Organic, and Biological …

Biochemistry

ISBN:

9780134015187

Author:

John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson

Publisher:

PEARSON

SEE MORE TEXTBOOKS