Describe the steps/proteins of the pathway that starts with a growth factor binding to a receptor tyrosine kinase (RTK) and leads to the synthesis or transcription of specific genes that activate the cell cycle past the restriction point.

Q: Evolution Thinket #10 Pretend you are a white moth during the Industrial Revolution. How does your…

A: This is fun but it was actually happens in north west region of England. It is called industrial…

Q: Question 2 Horse evolution is well documented in the fossil record. Describe three major trends in…

A: Evolution is described as the changes in the characteristics of an organism that takes multiple…

Q: Consider the following proteins with their pl values (apply the basic concept of the pl to answer…

A: Proteins are made of amino acids sequences joined together by peptide bonds. The pI of protein is…

Q: Question 2B please.

A: Agglutination is the clumping of the red blood cells with the respective antibodies added to the…

Q: Which of the following is mismatched? OK antigen-capsule OH antigen-flagellar O All of the choices…

A: An antigen is a type of marker that tells your immune system whether or not something in your body…

Q: 3. Counting Barr Bodies How many Barr Bodies would be present in cells of individuals with the…

A: Barr bodies are X chromosomes that are inactive in female mammalian cells. Barr bodies are named…

Q: 5. If the hypothetical restriction endonuclease CutVI were to recognize and cleave a circular piece…

A: A restriction endonuclease is an enzyme that recognize specific sequence present on DNA and cleaves…

Q: 2. It has historically been argued that competition drives evolution. However, some believe that…

A: Thank you for the question Answer : In modern times it is believed that collaboration is more…

Q: 1. What is the blending theory of inheritance? Name an example of genetics (that you've noticed in…

A: Introduction: The mechanism in which the parental traits are copied into the offspring belonging to…

Q: Question is mentioned in the attached file

A: In the bacteria, Salmonella typhimurium a series of mutations occurs that results in the requirement…

Q: Question is attached

A: In a chemical reaction, the half-life of a species is defined as the time taken by the species to…

Q: Question is attached

A: Chemical equilibrium, a condition in the course of a reversible chemical reaction in which no net…

Q: Question 10. After liquid atomization (nebulization) of DNA, it is necessary to repair the ends of…

A: Nebulization is a process of fragmenting DNA into smaller pieces by exposing it to a high-pressure…

Q: Using Table 1 from the lab introduction reading answer the following question: You see a cell that…

A: Cell wall  The non living component, covering the outmost layer of a cell. Its composition varies…

Q: 1x GGCGAUGGGCAAUAAACCGGGCCAGUAAGC Identify the start codon, and determine the complete amino acid…

A: Translation is the process of synthesis of proteins from mRNA. Proteins are synthesized by adding…

Q: Evolution Thinket #7 Explain the idea of "survival of the fittest" with regards to a population of…

A: Beavers are large gardens of the genus castor which are the native of the temperate Northern…

Q: Now you will translate the amino acid sequence for the given tRNA strand. Remember that codons are 3…

A: According to Bartleby guidelines,  we are supposed to answer first three subparts in case of…

Q: 9-10. Refers to the torso model below. 41

A: It is gastric artery

Q: Question is attached

A: Mole ratios are used as a conversion factor between products of the reaction and reactants of the…

Q: Identify the primary function(s) of hyaline cartilage. Select all that apply. > View Available…

A: Cartilages- The cartilages are the firm and softer tissue that is more flexible and present…

Q: 5 You inoculate single white colonies into medium plus ampicillin, and the next day you isolate the…

A: Plasmids are circular DNA molecules that have the ability to replicate independently of the host…

Q: . How would the rapid accumulation of succinyl-CoA affect the rate of glucose oxidation?

A: Cellular Respiration is the oxidative process through which energy is obtained from the food. The…

Q: Noncompetitive Inhibitors You can think of noncompetitive inhibition as a combination of both…

A: Enzymes are high molecular weight proteins that catalyse biochemical reactions. They contain an…

Q: question number 5 please

A: Differential centrifugation is a process used to separate various cell organelles and other…

Q: 9. During his voyage aboard the HMS Beagle, Darwin noticed that similar environments in different…

A: Introduction  The Galápagos Islands are a Pacific Ocean volcanic archipelago. It's regarded as one…

Q: Evolution Thinket #| A bird lives on an island that is covered in orange trees. Draw and describe…

A: Due to adaptation on environment, organism can change their body structure, food habit and all those…

Q: 9. A researcher measured the absorbance of a sample of C. vulgaris and found it to be 0.05. What is…

A: Ans 9.Beer lambert's law states that there is direct linear relationship between the absorbance and…

Q: bulb-urethral gland corpus cavernosa corpus spongiosum ductus deferens external urethral orifice…

A: The male reproductive system refers to the organs and glands of the male that are essential in…

Q: QUESTION 13 Titration of amino acids by a strong base, for example NaOH, results in two pks. The…

A: Amino acid consists of ionizable groups. The predominant ionic form of the amino acid is determined…

Q: Use the graph below to answer the questions 8 and 9 0.15- 0.10- + C.vulgaris 2714 0.05- + M.…

A: Algae are a wide category of photosynthesis-capable aquatic creatures. Seaweeds (for example…

Q: Q5. When Mendel crossed a large number of tall pea plants with short pea plants, all F1 plants were…

A: In 1865, Mendel gave a talk to the local natural history society about the results of his research…

Q: Adipocytes store fat in phospholipid-coated droplets in the cytosol. The protein perilipin is also…

A: Perilipin, also recognized as a protein associated with lipid droplets, is a protein that is…

Q: QUESTION 10 Which of the following is not considered part of the cell cycle. Go G1 G2 S-phase…

A: The cell cycle: It has 4 phases. G1-phase is the first growth phase. S-phase is the phase where DNA…

Q: Extension Questions 14. Other polar molecules include nucleic acids and some proteins. Look at the…

A: DNA, or deoxyribonucleic acid, is the hereditary material in humans and almost all other organisms.…

Q: All of the following are true about grasses except

A: Grasses are angiosperms.

Q: Question is attached

A: The lac operon is an Operon or a collection of genes with a single promoter. The genes in the operon…

Q: In a monohybrid cross, which of the following can result in the heterozygote displaying a different…

A: Everyone wonders why brothers and sisters look so similar to one another. This is when heredity…

Q: Normal cardiac tissue Normal Aorta Artherosclerosis Myocardiac infarct Compare and contrast the…

A: Cardiac tissue is specialized muscle tissue that makes up the walls of the heart. It is responsible…

Q: Question #20 Some substitution mutations result in a malfunctioning protein, but others do not. What…

A: A mutation is a change in the DNA sequence that can occur naturally or be induced by external…

Q: Match pairs of terms that are opposing (they have opposite meaning or they apply to the same aspect…

A: Inheritance is a phenomenon which determines how traits are moved on from parent generation to next…

Q: The most common corn grown by Native Americans in northern North America was which of the following?…

A: Flour  is a very popular category of corn which is grown  in North America. This variety is…

Q: QUESTION 16 Which statement incorrectly pairs the cell type with its function? Satellite cell -…

A: Neurons are extremely specialized cells that form the core of the nervous system. The nervous system…

Q: Fun Non Graded Question

A: Classification is the biological method used to differentiate living organisms according to their…

Q: 5) Suppose that 50% of the alleles at a specific locus are dominant (A), and the only other allele…

A: The principle that demonstrates the constant value of the genotypic frequency in every succeeding…

Q: Reabsorption of a bicarbonate ion requires all the following, EXCEPT: Direct transport of…

A: In the human body, the fluid waste excreted by the kidney gets stored and eliminated in a regulated…

Q: Six pure-breeding strains for eye color mutations in Drosophila are developed and crossed. Red is…

A: The "mutation" alters allele frequencies by constantly introducing new alleles, which can be…

Q: Pick an extinct animal of your (no dinosaurs). What do you think would happen if we brought this…

A: Ecology is the study of interaction of organisms with one another and with the environment. Ecology…

Q: You do some additional work with the magic beans and collect more mutants for seed coat color and…

A: Gregor Johann Mendel , the father of Genetics was the first to workout the patterns of inheritance…