All of the following are true about grasses except

Q: QUESTION 9 Prosthetic groups in the class of conjugated proteins known as glycoprotein are composed…

A: Conjugate protein has protein component as well as non-protein component joined together either by…

Q: 5. If the hypothetical restriction endonuclease CutVI were to recognize and cleave a circular piece…

A: A restriction endonuclease is an enzyme that recognize specific sequence present on DNA and cleaves…

Q: Genetically modified crops include all of the following except O all of the above herbicide…

A: Plants, bacteria, fungi and animal whose genes have been altered by manipulation are called…

Q: A geneticist is trying to determine how many genes are found in a 300,000 bp region of DNA. Analysis…

A: The question mentions that the geneticist is trying to figure out the number of genes that could be…

Q: - MatEning! Match the following with the correct definition. Salivary amylase A. Protein-coated…

A: The digestive system is responsible for digestion and absorption of nutrients. Digestion is…

Q: Question 13 0.5 pts From your reading and Table 1, answer the following questions: And infertile man…

A: The sperm must be healthy inorder to fertilize the egg. It accounts for the health of the person…

Q: If 96 out of 200 individuals in a population express the recessive phenotype, what percent of the…

A:

Q: 7. If the electrical leads were reversed by mistake (red connected to black), what would be the…

A: Gel electrophoresis is a technique which is used to separate the DNA on ths basis of size, charge…

Q: If there are 1,000 molecules of water INSIDE a cell and only 150 molecules of water OUTSIDE of the…

A: There are different types of transport system that help to move the molecule into and out of the…

Q: Using Table 1 from the lab introduction reading answer the following question: You see a cell that…

A: Cell wall  The non living component, covering the outmost layer of a cell. Its composition varies…

Q: 1x GGCGAUGGGCAAUAAACCGGGCCAGUAAGC Identify the start codon, and determine the complete amino acid…

A: Translation is the process of synthesis of proteins from mRNA. Proteins are synthesized by adding…

Q: QUESTION 14 The pks of histidine for a-carboxylate =1.8, for a-amino =9.33; and for imidazole (side…

A: Amino acids are the molecules that join to form a protein structure. The bond formed between two…

Q: Using this diagram and the points indicated (A, B, C) please explain how to treat congestive heart…

A: A chronic progressive condition affecting the cardiac muscle's pumping power is Congestive heart…

Q: 9. During his voyage aboard the HMS Beagle, Darwin noticed that similar environments in different…

A: Introduction  The Galápagos Islands are a Pacific Ocean volcanic archipelago. It's regarded as one…

Q: I 7. Sarah believes that giraffes have long necks because those with long necks were able to reach…

A: Evolution is the change in characteristics of species from one generation to another.  Charles…

Q: If a person is severely dehydrated you would expect to see all of the following EXCEPT Answers:…

A: Dehydration occurs when more water and fluids leave the body than enter it. Symptoms of dehydration…

Q: question 16

A: Heart is the major organ of the cardiovascular system. It is the mesodermally derived organ and it…

Q: 5. In cats the allele for short hair is dominant over the allele for long hair. A short haired male…

A: Mendelian inheritance: This refers to the inheritance of those traits that are controlled mainly by…

Q: QUESTION 13 Titration of amino acids by a strong base, for example NaOH, results in two pks. The…

A: Amino acid consists of ionizable groups. The predominant ionic form of the amino acid is determined…

Q: Use the graph below to answer the questions 8 and 9 0.15- 0.10- + C.vulgaris 2714 0.05- + M.…

A: Algae are a wide category of photosynthesis-capable aquatic creatures. Seaweeds (for example…

Q: Adipocytes store fat in phospholipid-coated droplets in the cytosol. The protein perilipin is also…

A: Perilipin, also recognized as a protein associated with lipid droplets, is a protein that is…

Q: 12-14 Refers to the model below. 12. Name the artery at the arrow. Name the anatomical region in…

A: The human circulatory system comprises blood, blood vessels, and the heart. The blood circulating…

Q: Extension Questions 14. Other polar molecules include nucleic acids and some proteins. Look at the…

A: DNA, or deoxyribonucleic acid, is the hereditary material in humans and almost all other organisms.…

Q: 8. A hypothetical population of 100,000 humans has 68,240 individuals with the blood type AA, 28,735…

A: According to the Hardy-Weinberg principle the allele frequency in a population remains constant if…

Q: QUESTION 16 Which statement incorrectly pairs the cell type with its function? Satellite cell -…

A: Neurons are extremely specialized cells that form the core of the nervous system. The nervous system…

Q: 5) Suppose that 50% of the alleles at a specific locus are dominant (A), and the only other allele…

A: The principle that demonstrates the constant value of the genotypic frequency in every succeeding…

Q: question 17

A: Heart is the major organ of the cardiovascular system. It is the mesodermally derived organ and it…

Q: Reabsorption of a bicarbonate ion requires all the following, EXCEPT: Direct transport of…

A: In the human body, the fluid waste excreted by the kidney gets stored and eliminated in a regulated…

Q: Mitochondria is an example of this type of organelle (best) cell type specific organelles…

A: cell is the basic structural and functional unit of the body, cells are bound together performing a…

Q: 5. Glucose is frequently administrated intravenously to patients as a food source. A new resident at…

A: Glycolysis is a metabolic-cytoplasmic pathway which uses one glucose molecule as a substrate to form…

Q: Which of the following statement is true for inhalation? O Intrapulmonary pressure decreases and…

A: Respiration is the process of taking oxygen and releasing carbon dioxide outside. The breathing is…

Q: 26. Liver cell makes some enzymes with the endomembrane system and transports the manufactured…

A: Endomembrane system is formed by some cell organelles to perform a special function like vesicle…

Q: 17. Describe the sequence of events of chemical synaptic transmission

A: In our body, each and every mechanism occurs in a systematic way; even if there is any physiological…

Q: QUESTION 5 Which of the following is FALSE about individuals with genius IQ's? a) IQ scores are…

A: IQ is defined as the ratio of mental and chronological age multiplied by 100. So basically…

Q: 15. Assume that a scissor cut is made at the red line so that the superior chambers are physically…

A: The heart of frogs are the main pumping station in their closed circulatory system and consist of…

Q: A) Please explain the differences between these isozymes as shown by the Michaelis- Menten plot. B)…

A: Isoenzymes : The enzymes that are characterised by the same function but possess different…

Q: QUESTION 5 The rate of a reaction, catalyzed by a Michaelis-Menten enzyme, was measured using…

A: Enzymes are a class of proteins that serves as a biological catalyst during the chemical reactions…

Q: Extension Questions 14. Other polar molecules include nucleic acids and some proteins. Look at the…

A: INTRODUCTION Answers of question 14, 15 & 16 are given below.