Describe sequence alignment. What kind of information do we obtain from pair wise or multiple sequence alignment? Also write down their applications in the field of bioinformatics. Enlist some softwares used to perform alignment.

Describe sequence alignment. What kind of information do we obtain from pair wise or multiple sequence alignment? Also write down their applications in the field of bioinformatics. Enlist some softwares used to perform alignment.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Related questions

Q: please list all possible products in a sequencing reaction using ddGTPA as a terminator based on the…

A: Ans: Chain termination sequencing: It is sanger sequencing method developed by Frederick sanger. The…

Q: Biochemistry: Site-directed mutagenesis, in which individual amino acid residues are replaced with…

A: Enzyme activity is used to assess the catalytic activity of an enzyme. One enzyme unit (U) is the…

Q: Question:- Can you please explain the general rule on how to manually align these sequence?? i am…

A: DNA sequencing is a technique for determining the exact sequence of bases (A, C, G, and T) in a DNA…

Q: Compute the [A + C]/[T or U] +G] ratios of the DNA and RNA models in Figure 1. Do you expect the…

A: Introduction DNA Is The Genetic Compound Containing All Of The Information About A Living Thing's…

Q: Direction: On the worksheet, all the DNA sequences run from 3' to 5'. Supply the corresponding amino…

A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Consider the λ bacteriophage DNA molecule as shown in Figure 21.14. Total digestion with the two…

A: DNA or deoxyribonucleic acid is a type of biomolecule. It is a polymer of deoxyribonucleotides…

Q: principles, advantages disavantages of DNA and RNA microarrays and Taqman SNP analysis and their…

A: SNP stands for single nucleotide polymorphisms. It is a polymorphisms in which variation in DNA…

Q: James Noonan and his colleagues (J. Noonan et al. 2005. Science 309:597–599) set out to study the…

A: Deoxyribonucleic acid (DNA) sequencing is the process of determining the nucleic acid sequence based…

Q: Calculate the dynamic programming matrix and the optimal local and global alignment for the DNA…

A: a: GAATTC b: GATTA Scoring:- +2 for a match -1 for a mismatch -2 L for linear gap

Q: The DNA sequences that are most conserved between human and mouse would most likely be located in:…

A: Most conserved DNA sequences between human and mouse.

Q: Design a pair of primers (22 nucleotides long each) for the following sequence to clone the full…

A: Primer is a short nucleic acid sequence that provides a starting point for DNA synthesis. It is used…

Q: Calculate the number of phosphates, deoxyribose and ribose, and nitrogenous bases needed for DNA and…

A: Nucleotide Organic molecule with a basic composition of a nitrogenous base, pentose sugar and…

Q: Repeated sequences can be classified according to theirorganization in the genome as well as…

A: The heredity or inheritance is defined as the passing of traits from parents to their offspring. The…

Q: Two sequences aligned using one of the BLAST programs produce an alignment with an expected value…

A: *A BLAST alignment will have an pair of sequences in which every letter in one sequence is paired…

Q: Sequence alignment 1- Define the global and local alignments 2- What are the differences between…

A: The process of aligning two or more protein (or nucleic acid) sequences to establish amino acid…

Q: A purified recombinant protein is analyzed for molecular weight by SDS-PAGE at pH 8.5. From the…

A: Proteins undergo post translational modification during which they are folded and chemically…

Q: According to Picotti (2013), Rudi Aebersold (a leader in mass spectrometry-based proteomics) hopes…

A: The application of scientific and technical principles to the processing of the material by…

Q: The specificity of Watson-Crick nucleobase pairing enables the biological information to be encoded…

A: Adenine, guanine, thymine, and cytosine are the nitrogen bases in the DNA. Adenine, guanine, uracil,…

Q: Corn_AA DVVINHRCA---DYKDGRGIYCVFEGG---TPDSRLDWGPDMICSDDTQYSN--GRG 16 :: Figure: Sequence alignment…

A: Sequence alignment is defined as the arrangement of sequences of DNA, RNA, proteins to identify…

Q: The difference between local and global sequence alignments is that local alignment

A: 3.option A Basic Local Alignment Search Tool (Blast ) one of the most common tools used to examine…

Q: Dideoxysequencing relies on which one of the following choices: A):Random stopping of one of many…

A: Introduction :- Dideoxysequencing is used in sanger sequencing. Sanger sequencing is a DNA…

Q: Outline 5 factors to be considered when performing a similarity search with a short…

A: Similarity Searching is a method used in bioinformatics. This method involves searching for…

Q: Method on the following 5 sequences and find the best multiple sequence alignments. Sequence # 1:…

A: Progressive alignment is a heuristic for multiple sequence alignment that does not optimize any…

Q: How many base substitutions are there between these sequences? Count ONLY the instances where there…

A: Sequence alignment involves the comparison of sequences of a particular gene from various organisms…

Q: 1a) In MALDI-TOF data, when performing peptide mass mapping search, the peptide masses and the…

A: Protein identification with the help of mass spectrometry (MS) is an major step in proteomic…

Q: 3a)ClustalX software was used to perform multiple sequence alignment of the following five Nco…

A: Some frequently performed analysis via bioinformatics are DNA sequence analysis, amino acid…

Q: ZFNs What is it? And how it works in genome editing?

A: Zinc-finger nucleases are counterfeit limitation catalysts (artificial restriction enzyme) produced…

Q: Q.No.4. A) Design a oligonucleotide probe for provided gene sequence using all the guidelines for…

A: Oligonucleotides are defined as the short stretches of the DNA or RNA which are single stranded.…

Q: When comparing (i.e., aligning) two or more genetic sequences, itis sometimes necessary to put in…

A: Introduction Sequence alignment is necessary to compare sequences. This can be used to find the…

Q: Sanger sequencing originally used 4 lanes in gels. These lanes represented sequences of different…

A: In manual Sanger sequencing, four PCR reaction are set up, each with only a single type of ddNTP…

Q: 7. A 1000 bp EcoRI restriction fragment contains a gene you are interested in. The fragment was…

A: EcoRI is a restriction endonuclease enzyme found in the E. coli bacteria. It's a restriction enzyme…

Q: What is the best analysis for estimation of family sequence conservation of domains? Enlist any two…

A: A gene is the basic physical and functional unit of the heredity. Genes are composed of the DNA.…

Q: 33. Genes for medically important proteins can be cloned and inserted into bacteria, as shown in the…

A: Recombinant DNA is a technique discovered by scientists that allows a human gene to be inserted into…

Q: Provide the consensus sequence for the first three actual sequences shown in Figure

A: Consensus sequences also known as canonical sequences can be determined by aligning nucleotide…

Q: The estimated size of fusion protein of an antibiotic (540bp) and an anti-inflammatory agent (630…

A: Size of antibiotic is 540bp. It will code for 180 amino acids. This is calculated by 540/3 = 180,…

Q: The optimal design of primers is critical to the effective amplification of DNA sequences. i)…

A: INTRODUCTION Polymerase chain reaction (PCR) is a method widely wont to rapidly make millions to…

Q: Fill in the gaps? One major goal/motivation in the development of synthetic genomes is ...... .…

A: In some ways, synthetic biology is similar to genome editing as both involve changes in the genetic…

Q: Southern and Northern blotting are powerful molecular biological tools based on hybridization of…

A: There are basically 4 types of blotting: Southern blotting. Western blotting. Northern blotting.…

Q: write down the applications of pair wise and multipal sequence alignment in the field of…

A: Multiple sequence alignment or MSA of nucleic acids i.e. DNA, RNA and proteins is nowadays one of…

Q: Sanger sequencing originally used 4 lanes in gels. These lanes represented sequences of different…

A: This method makes use of the mechanism of DNA synthesis by DNA polymerase DNA polymerase requires…

Q: HgaI recognizes a specific 5 bp sequence. How frequently would you expect a specific 5 bp sequence…

A: Restriction enzymes are the molecular scissors and are used to cut at a specific site. These are…

Q: The specificity of Watson-Crick nucleobase pairing enables the biological information to be encoded…

A: The double helical structure of DNA was discovered by Watson and Crick through diffraction studies.…

Q: Protein sequences which are usually more advantageous than DNA sequence in the comparative pairwise…

A: The term pairwise sequence alignment refers to the process of lining up of two sequences to get the…

Q: Protein sequences are usually more advantageous than DNA sequence in the comparative pairwise…

A: Pairwise analysis of sequences helps in finding out the similar regions in the given set of two…

Q: Which of the following mutational changes wouldyou predict to be the most deleterious to gene…

A: Introduction :- A mutation is a change in our DNA sequence that happens as a result of errors in DNA…

Q: A student is running gels to sequence a DNA fragment as below. In addition to running four…

A: Sanger's sequencing method. It is a method based on DNA synthesis. In normal DNA synthesis,…

Q: 4.7 Well-conserved regions in multiple sequence alignments: A. reflect areas of structural…

A: Multiple Sequence alignment is the process of aligning three or more sequences of protein or nucleic…

Question

100%

Q No. 2 Describe sequence alignment. What kind of information do we obtain from pair wise or multiple sequence alignment? Also write down their applications in the field of bioinformatics. Enlist some softwares used to perform alignment.

Plz write the answer with headings of sequence alignment

Pair wise alignment

Multiple sequence alignment

And the name of softwares

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

Sequence alignment

Step 3

Step 4

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

alignment in genomic research, list types of alignments and corresponding errors associated with specific sequence assemblies. Are there methods of alignment error filtering?
Perform Progressive Alignment Method on the following 5 sequences and findthe best multiple sequence alignments.Sequence # 1: ATCCAATTTTSequence # 2: ACTGACCSequence # 3: ATGGCCATTSequence # 4: ATCTTCTTSequence # 5: ATTGCCATT
Align two sequences: horizontal – GGAATGG, vertical – ATG, m= 2, mm = 0, g/o = -2, g/e = -1. Complete the NW matrix below and show the alignment paths. Write down and score all optimal alignments. Part 2. Dynamic Programming Assignment, Needleman-Wunsch Algorithm, Affine Gap Cost Click the shapes and move them using arrow keys (or drag). Click the shapes and right-click to copy/paste or click and use Ctrl + C to copy, then Ctrl + V to paste (in MS Word). 0000 Align and score all optimal alignments here. 0000
In the following gel showing stained bands of the Alu insertion sequence, what is the genotype of individual 2? 941 bp 641 bp->>> 1 2 3 4 5 6 Homozygous for the 641 bp sequence that does not contain in the Alu insertion Heterozygous, containing one 941 bp sequence and one 641 bp sequence O Homozygous for the 941 bp sequence containing the Alu insertion
List down and briefly describe three other sequence alignment tools other than BLAST used in Bioinformatics.
What are the similarities and/or differences between interpreting Multiple Sequence Alignment (MSA) of conserved sequences at the DNA level versus the Amino Acid level? Please site references if possible and have 5+ sentences.
a. What are the purposes of sequence alignment? b. Define the local alignment and global alignment C. Compare local alignment and global alignment d. What is "Dot Plot" and why it is used?
This descriptor refers to the highest alignment score of all matched sequences to the sequence placed in the BLASTn search. Query cover Maximum score and Total score E-value Ident Accession number
BIOINFORMATICS Please solve the questions about(Akt 1) can use NCBI Please help me 1.What is the official genename of the gene? Do you have another names? 2.Find nucleotide sequence of reference sequence of your gene. 3.Find refseq transcript number of your gene. Make BLAST of two of refseq transcript. Show the Blast result. (You can take screenshots) 4.Find refseq protein sequence number of your gene. And download the amino acid sequence of your gene. 5.What is the chromosome number is it located? 6.What are the coordinates of the gene? 7.How many bp is the length of the transcript? (Hint: not RefSeq transcript) 8.What is the transcript access number? 9.How many exons and introns does it have? 10. What is the sequence of the first exon? 11.How many nucleotides long is each exon? 12. What is the UniProt accesion number of your genes for human?
You wish to align a 300 bp nucleotide sequence to a genome. Which of the following pairwise sequence alignment algorithms is BEST suited for this task? Global alignment or Local alignment? Please explain or elaborate why you chose this alignment algorithm.
Design a oligonucleotide probe for provided gene sequence using all the guidelines for efficient probe designing. ACAACCCCAAGCCTTCAACCACCCCCTTCCCCCAAATTAGAGATCGATCTCAAGAAGAAGAATGGGTTCCGTCTCTCGCTCTTCTTTGGATCAGAAGCTGGCCATGGCAAAGCGCTGCTCCCACGAGGGAGTTGTCGCGGGAGCAAAGGCGGCCGTGGTTGCAACTGTTGCCTCGGCCATTCCTACTTTGGCTAGCGTTAGGATGATCCCATGGGCGAGGTCCTTCCTTAATCCCGCAGCTCAGGCCCTCATCGTTTCATCAGCGGCGGGGGCGGCGTACTTCATAGTTGCGGACAAGAC
discuss using named examples some of the disadvantages of protein engineering using site directed and random mutagenesis