1、You have a 250 bp DNA sequence from a human protein-coding gene.  What's the best tool to find out which gene matches this sequence?   BLAST   A Clustal algorithm (such as Clustal Omega)   A Burrows-Wheeler algorithm (such as BWA)   Just Google it   2、Sequence alignment algorithms like Burrows-Wheeler were primarily designed to handle many (millions) of short sequences and match them to a reference genome efficiently.  Another property of these algorithms makes them suitable for use with RNAseq data.  What property is this?   Burrows-Wheeler can distinguish which strand of reference genome matches a sequencing read.   Burrows-Wheeler can align a sequencing read that matches two different exons.   Burrows-Wheeler uses a pre-compiled and compressed index of the reference genome.   Burrows-Wheeler can be parallelized.

Q: a. What are the purposes of sequence alignment?

A: Sequence alignment is a method by which one can arrange sequences of DNA, RNA and protein so as to…

Q: pMdawn is digested with EcoR1, and BamHI. Resulting in fragments shown below: EcoRI: 20 kb BamHI:…

A: Plasmids are double-stranded circular DNA found in bacteria. These contain genes related to…

Q: What is the main reason for using a cDNA library rather than a genomic library to isolate a human…

A: Introduction :- cDNA stands for "complementary DNA". It is a type of DNA that is synthesized from…

Q: solve this with step by step calcuations please

A: 1. **Amount of DNA in the 1-kb band:**  We want to ensure that we have enough DNA in the 1-kb band…

Q: Like many biotechnologies, CRISPR/Cas9 was originally discovered as system that naturally occurs in…

A: Biotechnology is the branch of biology which deals with the utilisation of cells and biomolecular…

Q: About 60% of the base pairs in the human genome are AT. If the human genome has 3.2 billion base…

A: An enzyme produced from the bacteria which recognizes specific base sequence in DNA and cut the DNA…

Q: 4) Consider three different kinds of human libraries: a genomic library, a brain cDNA library, and a…

A: Genomic deoxyribonucleic acid (gDNA) is representative of the chromosomal DNA present in the cells…

Q: please help solve

A: CRISPR-Cas system is the naturally present defense system in the prokaryotes.

Q: When aligning the three sequences (ATGC, AATC, AATG), one can use a 3-D "Manhattan Grid", with each…

A: ANSWER: ATG-C AAT-C AA-TG

Q: 1)explain why it is far less important for RNA Polymerase to have proofreading activity than it is…

A: Fidelity of replication is the most important for the very existence of an organism. Besides its…

Q: Below is shown an 8kb region of the human genome, with the proportion of the nucleotides that are…

A: Introduction :  Any segment of a gene that will be included in the mature RNA produced by that gene…

Q: Some synthetic biologists have proposed creating an entirely new, freeliving organism with a minimal…

A: A genome is the entire DNA collection of an organism, including all genes. All the details needed to…

Q: 8. Given the following two sequences, create a pairwise alignment by hand. Do not place any gaps in…

A: Introduction :- When the cell needs energy, ATP can be taken out and used to fuel processes or…

Q: 5'-GATTACAATAGGAATTC~~ GAATTCTCGTGACTCCG-3' 3'-CTAATGTTATCCTTAAG~ CTTAAGAGCACTGAGGC-5' Which of the…

A: PCR or polymerase chain reaction is a DNA amplifying technique where a short piece of a gene or a…

Q: Which lane in the gel the gel electrophoresis experiment correspond to reaction of the circular…

A: Restriction endonucleases are specific enzymes that are responsible for cutting the phosphodiester…

Q: explain why it is far less important for Primase to have proofreading activity than it is for DNA…

A: DNA proofreading is error correction process, in which DNA polymerase checks the each nucleotide…

Q: You would like to design a method to treat the most common mutation that causes sickle cell anemia…

A: Precise genome editing is a potential technique for discovering causative genetic variations and…

Q: How would you approach this problem? You plan to sequence the following DNA by Sanger sequencing.…

A: Sanger sequencing, developed by Frederick Sanger in 1977, is a widely used method for determining…

Q: Scene Electrophoresis o the questions below, including a labeled picture of you your gel, you had to…

A:

Q: These sequences are obtained as part of a human genome sequencing project using a library of 150 kb…

A: Contigs are the overlapping sequences present on DNA fragments. Each set of contigs is counted as…

Q: Now you have the gene sequence. Now you would like to clone it into an expression vector to grow up…

A: Answer. The majority of eukaryotic genes contain non-coding DNA. The genes tend to have a split…

Q: Assuming that the mean size of the human sau3AI partially digested fragments clones is 3kb,…

A: Human sau3AI is a tool used to help predict and diagnose disease. It is a blood test that looks for…

Q: This is from the Wilson et al. article.

A: Primer PC3mod (PURPLE)Recognition sequence: 5' TGCCAGCGAGTCAAGTCGGGAACTCT 3'Direction of…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.