In a test tube, a particular DNA polymerase has an error rate of 1 mistake in every 106 bases copied. Why is the mutation rate in a cell that uses this DNA polymerase much lower? Not all mutations can be detected easily. O The DNA polymerase has a proofreading function. Mutations do not occur if mutagens are not present. Repair mechanisms correct many errors made by the polymerase The polymerase is more careful in replicating regions where genes exist.

Q: Please find the answer to all three questions PET and fMRI are ____ techniques which means they…

A: Neuroimaging is sometimes referred to as brain imaging techniques that represents the techniques…

Q: The first three codons for a mRNA sequence are 5’ GGC AAG UCU 3', What anticodons will the correct…

A: * mRNA that is also called as messenger ribonucleic acid is a single stranded RNA corresponds to…

Q: How can human stem cells be used to repair adult CNS dysfunctions? Please, I really appreciate the…

A: The nervous system disorders include cancer, congenital diseases, and neurodegenerative diseases.…

Q: red vs. white fiber

A: Red fiber- This type of fiber is also called the slow-twitch fiber and they store a high amount of…

Q: The answer here is incorrect. Can you rework it?

A: When the amount of stored fats in the body increases, it can affect the expression of various…

Q: How would pyrimidine dimers from the sun effect replication of this gene sequence?…

A: Pyrimidine dimers are the dimers formed between two pyrimidine molecules. Usually it forms between…

Q: Considering the time limit what should be opened first

A: Effectiveness and task prioritization are basic within the planning of an urgent surgical strategy,…

Q: Explain the RAAS mechanism. brief

A: Introduction: The cells, tissues, organs, and organ system are interlinked and live together in a…

Q: 9. Compare and contrast the two major types of neuronal pathways. Give an example of each.

A: The fundamental units of the brain and spinal cord is called neurons. It is also called nerve cells.…

Q: . What would be the consequence of an inactivating mutation in the HO gene in an a cell? [Select]

A: Inactivating mutation This mutation is also called as loss of function mutation. The product of this…

Q: What is the enhancer element? Select an answer and submit. For keyboard navigation, use the up/down…

A: In genetics, an enhancer is a small piece of DNA (50–1500 bp) that can be linked by proteins…

Q: Cell Form Function a. Spinal cord i. White matter ii. Gray matter b. Cerebellum i. Purkinje cells…

A: The spinal cord is a long tubular structure composed of nervous tissue extending from the medulla…

Q: Can someone please explain in detail how the Outer Membrane Proteins (OMP) system works?

A: The outer membrane of gram-negative bacteria contains a variety of proteins called outer membrane…

Q: act as signals between the components of the feedback loop.

A: Introduction A biological phenomenon known as a feedback loop occurs when a system's output either…

Q: Sequence A uuucccucuuagaauuaauucguaauauuuaucau uuaaauuuagcucccuccccccauuaauaaauaauu…

A: RNA molecules are formed with the help of template DNA strand in the process transcription with the…

Q: tatus: * Question Completion Which letter in the figure represents phlanges? O A. A O B. B OC.C O…

A: The letter D depicting the body part is the phalanges. Phalanges are the bones that constitute the…

Q: Songbirds sing using a type of muscle fiber called super fast-twitch muscles. These super…

A: Muscle contraction and relaxation are regulated by the levels of calcium ions in the sarcoplasm…

Q: _cells stimulate both arms of the immune response (one arm is self and the other arm is foreign)

A: According to guideliness we have to answer the first question only so please kindly post the 2nd…

Q: The cytoplasmic granule of RNA and protein that reads the message in mRNA is a/an____________ .

A: In cells, different parts have specific jobs in making and controlling proteins. One important part…

Q: Required information Watch the animation and answer the question(s) that follow(s). -0.00/5:30…

A: The cells of nervous system other than neurons which are incapable of generating and transmitting…

Q: dentify the following structures, please label your answers with the corresponding number and be…

A: Question  72) Reissner's membrane  73) Tectorial membrane  74) Outer hair cells

Q: In protein synthesis, DNA transcription records the genetic message, while ribosomal ______________…

A: Molecular Biology is the branch of biology that deals with a study of the composition, arrangement,…

Q: using STAR framework, discuss the ability to work within a team in  a clinical settings (150 words)

A: The STAR framework is essential to provide quality of care to the patients. The clinical team should…

Q: What are the key differences between rough endoplasmic reticulum and smooth endoplasmic reticulum.…

A: The cell is the structural and functional unit of an organism that perform all the activities. The…

Q: Identify any 10 structures. Select five and explain the function.

A: The histological and operational unit of the kidney is the nephron. Each kidney contains about 1.3…

Q: Chapter 5 Improving Flexibility The following are the videos you will need to watch for Chapter 5.…

A: The video is all about stretching and knowledge of muscles. This gives a message that before…

Q: What process is being depicted here? 3000 ÷

A: Protein synthesis stands as a pivotal process within our bodies, comprising two fundamental steps:…

Q: Neuron explanation

A: The coordination and balance in the body is mediated by the a network of cells that helps in…

Q: 37

A: Mitosis is a process where a single cell divides into two daughter cells.

Q: How many coding professionals are needed in a 60 bed hospital?

A: Medical coding professional is important to provide code for the various procedures that patient has…

Q: What do you think about integrated healthcare systems? Do you think healthcare organizations…

A: An integrated healthcare system, also known as an integrated delivery system refers to an…

Q: o not copy from anywhere please does a 50% similarity score for two proteins mean that they're the…

A: Proteins are made up of polypeptides, which contain one or more long chains of amino acid residues.…

Q: _____________________ is the capacity of structurallydifferent components of a system to perform the…

A: The body of multi-cellular organisms consists of several organs which work systematically to govern…

Q: _______________ ______________ act as signals between the components of the feedback loop.

A: Feedback loop  A feedback loop is a kind of loop where are final product or output of the system…

Q: Report the effect of lowering extracellular glucose levels on each molecule or enzyme shown below.…

A: A. Phosphofructokinase 2 is deactivated when the extracellular glucose level is lowered.   B.…

Q: 5. List the series of events at the membrane that generate an action potential, including the…

A: Neurons  The special type of cell which carry signal from stimulus to brain and vice versa.

Q: A diploid cell is shown below. The cell has three pairs of chromosomes (2n = 6). Which image below…

A: Mitosis is an equational division which is responsible for producing the genetically identical…

Q: Question 26 SHORT ANSVWER (recall) What is the SIZE of an average gene? (give a range, in bp or kb)…

A: The nucleus of a cell contains the nucleic acids which are responsible for the passing down of…

Q: Which of the following statement is true? Answers A- D If just one of the essential amino acid is…

A: There are three types of amino acids: Essential amino acids Nonessential amino acids Conditional…

Q: 1. Define each term listed as the Nursing Diagnosis Qualifier (NDQ). 2. Provide three (3) Nursing…

A: As a nurse, understanding Nursing Diagnosis Qualifiers (NDQ) and their associated Nursing Diagnosis…

Q: Explain the RAAS mechanism.?

A: The cells, tissues, organs, and organ system are interlinked and live together in a shared internal…

Q: hertability refers to

A: Genetics is the branch of Biology dealing with the study of genes including their structure,…

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.