Let's Apply In each of the following DNA sequences, write on your answer sheet the corresponding mRNA transcript and use the genetic code to determine the resulting amino acid sequence. Note that the given strands are in the 3° to 5' direction. 1. ТАССАТСССАСААТT mRNA: Amino acids: 7 2. TCTGAGTTCTTACTTCGAAGG (Proceed even without the start codon) mRNA: Amino acids: 3. AGTTACTTCAGAGCTATAACTTTC (Start with the start codon and end with the stop codon) mRNA: Amino acids:

Q: NUR 163 exam questions

A: Introduction- Nurse are the key persons of the health care team, they should be knowledgeable and…

Q: ABUSE AND NNEGELCT

A: Abuse is the actions that intentionally harm or injure another person physically, emotionally,…

Q: А C D

A: The instrument or electrical device that can be used for observing small objects like cells is…

Q: Briefly describe and explain how two cardiovascular diseases can be caused by atrial fibrillation.

A: Irregular puls of heart is one of the serious  causes of cardiovascular disease. Many cardiovescular…

Q: D C ши I H_

A: We are given an unlabeled diagram of a cross section of flower. We have to label the diagram.

Q: Muscle Mass and Weight Lifting OPositive O Negative O Zero

A:

Q: Above Below Q A Q B C D

A:

Q: IDENTIFY THE ARCUATE ARTERY

A: The kidney is a vital organ that performs many functions, one of the most important being the…

Q: Medications for diabetes

A: Diabetes Mellitus: Diabetes is a chronic medical condition characterized by high levels of glucose…

Q: What is the default setting for confidence level for 23andMe? (Meaning, what percent sure is the…

A: The confidence level in 23andMe refers to the degree of certainty the company has in the accuracy of…

Q: }} 1 {}} 2 3

A: The bandaging begins with a circular turn around the forehead. When bandaging the right eye, the…

Q: label

A: Histology is the investigation of the microanatomy of cells, tissues, and organs as observed through…

Q: Where did you answer the last 2 questions?

A: 5'UTR stands for untranslated region at the 5' end of the DNA sequence. 3' UTR stands for…

Q: Bleeding, abnormal excessive fluid discharge  Ending -ostomy

A: Ostomy causes a change in the way urine or stool exits the body as a result of a surgical procedure.…

Q: What would be the f2?

A: Drosophila has been widely used in genetic studies as it produces a large number of offspring and…

Q: In The Day of the Triffids, after most people in the world are blinded by an apparent meteor shower,…

A: The alleles are generally of dominant and recessive type and some other forms like codominant are…

Q: Use the pictures of the gels to fill out the pedigree and mark the genotypes of all of the family…

A: Homozygous  The condition where both alleles of a gene give same phenotypic expression.

Q: What would be the direct result of the enzymes in the acrosome not working properly?

A: WHAT IS ACROSOME ? The acrosome is a special kind of organelle with a cap like structure that covers…

Q: Can you do the first part

A:

Q: Can you answer question 6 please

A: There are beneficial bacteria in the gut,the gut microbiota contains over 3 million genes, making it…

Environmental health and hazards

An organism's environment is the environment in which it lives and has an impact on its well-being. The World Health Organization (WHO) defines environmental health as "those aspects of public health, such as quality of life, that are influenced by physical, chemical, biological, social, and psychosocial components in the environment." Environmental health is concerned with both natural and man-made settings in order to enhance public health. Environmental science, occupational medicine, toxicology, and epidemiology are the key subdisciplines of environmental health.