Consider the following sequence of DNA: 3'-TTA CGG-5' What dipeptide is formed from this DNA after transcription and translation? b. If a mutation converts CGG to CGT in DNA, what dipeptide is formed? c. If a mutation converts CGG to CCG in DNA, what dipeptide is formed? d. If a mutation converts CGG to AGG in DNA, what dipeptide is formed?

Q: How is the DNA unwound at the replication fork? What effect does this have on the DNA upstream of…

A: DNA It is a double stranded helical structure present in almost all eukaryotic cell.

Q: In proteins, a peptide read from the N terminal to the C terminal. Is there a kind of direction in…

A: The DNA double helix model is generally one of the best discoveries of the 20th century. DNA is…

Q: Why might some cells in the body, such as those in bonemarrow, be more susceptible to ribosomal…

A: Mutation It is the sudden heritable changes happening in the genotype of the organism which is…

Q: In chemotherapy, what are the mechanism of action of cisplatin and alkylating agents.  Why are these…

A: Chemotherapy is a medication treatment that employs the use of potent chemicals to kill rapidly…

Q: 1. Certain proteins that stimulate expression of a gene bind to DNA in a sequence specific manner…

A: Proteins are an important organic compound. Some proteins stimulate the expression of a gene bind to…

Q: 1. The nontemplate strand of a segment of double- helical DNA contains the sequence:…

A: Since you have posted a question with multiple sub-parts, we will solve the first 2subparts for you.…

Q: (b) How many forms can naturally occurring DNA exist in? Explain how these forms are characterized.…

A: DNA  Deoxyribonucleic acid  Genetic material in many species Has ds(double stranded) structure…

Q: Is the entire strand of DNA template strand of DNA transcribed at one time?  Explain answer

A: DNA is the genetic material in living organisms that is composed of polynucleotide strands. The…

Q: (a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT…

A: Introduction :- Mutations are the hereditary changes that occurs in the Genetic material (DNA) of…

Q: Explain

A: The question is asking to calculate the melting temperature (Tm) and the percentage of…

Q: Would the cell likely experience an issue due to the incorrect function of the protein produced by…

A: DNA ( deoxyribonucleic and) is a genetic material in most of the organism that appear as two…

Q: What is the basic recognition motif to which a N-linked glycan is added? A.S/T-X-X B.KDEL…

A: Introduction N-linked Glycosylation (NLG) Is A Complicated Biosynthetic Process That Controls…

Q: The E coli cell contains 107 non-specific DNA binding sites for R, 10 R molecules, and 1 Operator.…

A: In molecular biology, the particular binding of a regulatory protein to DNA could be a common…

Q: a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that…

A: DNA is the genetic material of almost all living organisms. It contains information that is…

Q: When Griffith incubated heat-killed virulent S strain bacteria with live avirulent R strains, he…

A: Griffith conducted a series of experiments and discovered the Transformation principle. S strain…

Q: onsider the following segment of DNA, which is part of a linear chromosome: LEFT…

A: Answer.  Transcription is a process of the formation of transcript (RNA). It takes place by the…

Q: A protein domain that recognizes 5-methylcytosine in the context of double-stranded DNA has been…

A: SET and RING-finger-associated (SRA) domain is involved in establishment and maintenance of DNA…

Q: Point mutations in multiple tumor suppressor proteins have been linked to cancer. For example…

A: In transcription only a segment of DNA and only one of the strand is copied into RNA.

Q: The first 15 bases of the original coding informational strand of DNA (which continues after what is…

A: Mutation can be divided into several categories. The types of mutation include missense mutation,…

Q: if the following DNA sequence were transcribed, which of the following describes the output of this…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: 5 to 3 direction, the DNA template strand should be  5'TTT-GGG-AAA-3'

A: mRNA and DNA are two types of nucleic acids that play crucial roles in gene expression and protein…

Q: 10. Given the following prokaryote sequence of DNA: Identify if any promoter sequences are present…

A: Disclaimer : Since you have posted a question with multiple subparts, we will solve first three sub…

Q: 1. The following is showing the process of translation with MRNA, TRNA and a ribosome. a) Label the…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Which of the following concerning progeria are false? Choose all that apply.

A: 1. Regularly, Zmpste24 slices pre-lamin to eliminate 50 amino acids.Zmpste24 is a catalyst engaged…

Q: Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which…

A: CF is caused by a mutation in a gene called the cystic fibrosis transmembrane conductance regulator…

Q: a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS…

A: DNA replication is a phenomenon in which DNA make itself using Enzyme DNA Polymerase . It occurs in…

Q: 2b) Suppose you generated a mutant E. coli strain in which it was DNA Polymerase I that was…

A: "DNA polymerases are enzymes that catalyse DNA synthesis during replication." The primary function…

Q: Identify the type of point mutation on the following strands (transition or transversion):  a. 5’…

A: The mutation is the sudden deleterious effects in the DNA sequences, they can arise when the DNA is…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.