Br Br Br ~ Br You NaN₂ DMF SN1 E1 SN2 E2 CH3CO₂H SN1 ☐ E1 SN2 ☐ E2 NaNH, NH3.0°C SN1 E1 SN2 E2
Q: What are the molecular weights of the proteins found in the different fishes?
A: Answer well explained above
Q: 20Classify the examples of humoral immunity as natural active immunity, artificial active immunity,…
A: Here is the classification and explanation for each type of humoral immunity example:Natural Active…
Q: What is an intuitive explanation of volume of distribution in pharmacology?
A: The volume of distribution (Vd) is a theoretical concept in pharmacology that is used to describe…
Q: Please help me solve 2. Explain the process in detail
A: Approach to solving the question: Detailed explanation: Examples: Key references: Biology
Q: None
A:
Q: Denote each of the following pairs as constitutional isomers or identical molecules. It may be…
A: a) We are given the molecular formula of the pair. From this, we find that both contain 4 C (carbon)…
Q: Determination of phosphorus in blood serum gave results of 4.40, 4.44, 4.64, 4.47, and 4.49 ppm P.…
A: Here n = 5 Mean of the sample is, xˉ=54.40+4.44+4.64+4.47+4.49 which equals 4.488 Now std deviation…
Q: Pleaseeeeeeeee explain the processs of this I’m so confuseddddddd………….
A: Refer to the solution
Q: Sodium carbonate reacts with HCI to produce carbon dioxide gas, water, and sodium chloride. Balance…
A: 1. Calculate the number of grams of sodium carbonate neededNote: Convert Units first and Solve for…
Q: A chemistry student weighs out .119g of hypobromous acid (HBrP) into a 250 mL volumetric flask and…
A: Given:Mass of hypobromous acid (HBrO) = 0.119 gVolume of acid solution = 250 mL or 0.250 LMolarity…
Q: Part 3 of 3 Consider these three monosaccharides. H H CH₂OH C=0 HO -H HO -H H -OH H- -OH H -OH HO HO…
A: Step 1: Isomers must have the same molecular formula1) Enantiomers are the mirror images of each…
Q: None
A: Approach to solving the question: Detailed explanation:In a system, constituents are defined as any…
Q: To prepare 1.00 L of a 50.0 mM NEM (N-ethyl morpholine, pKa of its conjugate acid is 7.67) buffer at…
A: Step 1: Step 2:Step 3: Step 4:
Q: Modify the mannose structures provided to show the structure of a disaccharide formed from two…
A:
Q: Draw the skeletal structure of a triacylglycerol that contains three molecules of caprylic acid.…
A: Step 1: Triacylglycerols (Triglycerides) Esters of glycerol and three fatty acids. They are the main…
Q: The monosaccharide shown below is the CH₂OH OH OH beta- L- D- alpha- Он OH anomer.
A: Option a: This option is incorrect because in a beta (β) anomer, the hydroxyl group (-OH) on the…
Q: 5 Justify your answer. Carbon dioxide (CO2) in the air dissolves in distilled water. The CO2 then…
A: Step 1:When pH = 7 , solution is neutral When pH >7 , solution is basic in nature. When pH<7,…
Q: Balance the following equations: a, b, c, d, & e Please explain thoroughly how and why I would…
A: Approach to solving the question: Detailed explanation:In balancing chemical equations, the number…
Q: Please explain question 1 thoroughly.
A:
Q: Draw the structure Rutinose: -L-rhamnopyranosyl-(16)--D-glucopyranose
A: 2D structure Conformation structure
Q: Assume that the formation of nitrogen dioxide 2NO(g) + O2(g) 2 NO2 (g) is an elementary reaction. A…
A: Given the reaction:2NO(g)+O2(g)→2NO2(g)The half-life of the reaction is inversely proportional to…
Q: A gas balloon has a volume of 82.28 liters when the temperature is 40.9 °C and the pressure is 799.3…
A: The first step is to convert the temperatures from Celsius to Kelvin because the gas laws are based…
Q: What is the sequence of a newly synthesized DNA segment if the template strand has each of the…
A: DNA segment comprise of 4 nucleotides in pairs, where adenine bonds with thymine (A=T) and cytosine…
Q: glutamate pyruvate malate fumarate Incorrect Answer oxaloacetate acetyl-CoA succinate citrate…
A: Solution: The citric acid (Krebs) cycle is primarily known for its role in energy production by…
Q: None
A: Step 1:Now we cheak different type of proton in molecule Step 2: Step 3: Step 4:
Q: How should a sample intended for total metals analysis be digested?
A: Step 1: Above there is all the explanation given.. Step 2: Step 3: Step 4:
Q: Label each monosaccharide as an α or ẞ isomer. Select the single best answer for each part. Part 1…
A: Since the Fischer Projection of any given carbohydrate is always the same, the Haworth Projection is…
Q: Complete the following table, which lists information about the measured acid dissociation constants…
A: Given Data:Acid A: Ka = 1.2 × 10-9 Acid B: Ka = 3.0 ×10-4 Acid C: pKa = 11.539 (Ka value needs to be…
Q: How many grams of potassium chlorate decompose to potassium chloride and 660. mL of O2 at 128. °C…
A: Step 1: Step 2: Step 3: Step 4:
Q: What are the modifying factors and toxic/therapeutic effects of cisplatin? Define all new terms…
A: Cisplatin is a platinum-containing anticancer drug used to treat various types of cancers, including…
Q: Glycogen synthesis and breakdown are most common in the liver and muscle. A very rare human disease…
A: Approach to solving the question: Detailed explanation: Examples: Key references: Biology
Q: None
A:
Q: Draw the skeletal structure for the organic product(s) formed when the following alcohol is…
A:
Q: What is the sequence of a newly synthesized DNA segment if the template strand has each of the…
A: Refer to the solution
Q: 4-methyl-2-pentene
A: part 1. To determine the product formed when 4-methyl-2-pentene is treated with water (H₂O) in the…
Q: Calculate the molality and boiling point of an antifreeze solution that is 50.0% by mass of ethylene…
A:
Q: What is the drug make up of heparin?
A: Heparin is a highly sulfated glycosaminoglycan, which is a type of long, unbranched polysaccharide.…
Q: Calculate the value of AG, if the value of AH is +1200 Kcal/mol, AS is +60 Kcal/mol, and the…
A: To find the Gibbs free energy change (ΔG) using the given values, we use the Gibbs free energy…
Q: Identify the structure of a fatty acid is trans 16:1 (9)
A: Option a:Structure: This option shows a fatty acid chain with 16 carbon atoms and one double bond in…
Q: None
A: Step 1: Find the MeanThe given percentages are:71.3%, 82.8%, 79.5%, 82.6%, 76.1%First, find the…
Q: Which of the following compounds might be antioxidants? Check all that apply. U CH3 CH3 H₁C H3C OH…
A: Step 1: Step 2: Step 3: Step 4:
Q: None
A:
Q: Please help me solve 4 and explain the process.
A: Detailed Explanation: Muscle Relaxation State:In the resting state, the muscle cell maintains a…
Q: 5 Why is it important to measure the masses of the NaCl and KNO3 samples in Part B?
A: It is important to measure the masses of the NaCl and KNO₃ samples accurately in Part B for several…
Q: Please help and explain homework
A: I answered your questions.
Q: A 2.0% (by mass) aqueous solution of novocainium chloride (C13 H21 CIN2O2) freezes at -0.235 °C. a…
A:
Q: 9. Which of these reactions will proceed spontaneously? a. Ni 2+ + H₂→ 2H+ + Ni b. Mg2+ + Pb+ SO2…
A: To determine which of these reactions will proceed spontaneously, we need to compare the standard…
Q: Please break this question down for me and draw the peptide too…….
A: Ionizable groups in the peptide sequence Ala-Arg-Lys-Ala-Asn-Ser-Ala-Ser modify its net charge…
Q: On the image showing the transcription of DNA to RNA, what does the letter F represent? Select the…
A:
Q: Help #15
A: The key to finding out the number of constituent amino acids is to rely on the basic structure of…
Step by step
Solved in 2 steps with 2 images
- + www-awu.aleks.com/alekscgi/x/Isl.exe/10_u-lgNslkr7j8P3JH-IQUHIQg6bJxmeSyVPHOEB1plef9xyC5Ca9QlbCmqT-TP-BcuGkqzvM9h_eXu2dblOXnFt00g1aPGkUe7G4... с O Biological Macromolecules Classifying mutations A certain section of the coding (sense) strand of some DNA looks like this: ATGAGTATCTAA It's known that a very small gene is contained in this section. In the table below, write the base sequence for two point mutations of this DNA, one silent, and one not. Silent mutation: Non-silent mutation: Explanation Check ☐ MacBook Air 0/5 Julianna X $ 00. 园 2024 McGraw Hill LLC. All Rights Reserved. Terms of Use | Privacy Center | Accessibilityн но- Н о CH ОН -H ОН CH₂OH Cu2+ (aq)tus: Second letter с A UUU Phe UUC J UCU UC UAU UAC J Ser UAA Stop UGA Stop A Tyr UGU] UGC Cys UUA UUG J Leu UCA UCG UAG Stop UGG Trp CUU CỤC CỦA CUG CCU] CC CCA CG CGU CGC CAU1 CAC J CAA CAG His Leu Pro Arg CGA Gln CGGJ AUU AUC le ACU ACC ACA AAUJASN AGU S Asn Ser AGC AGA Arg Lys Thr AAA AAGJ AUA AUG Met ACG AGG GAUASP GGU] GGC GGA GGG GUU GCU GUC GUA GCC GCA GCG GACJ Ala GAA GIU Val Gly Glu GUG GAGJ The template strand of a gene has the sequence 5' CTAGTTGGCACACTCCATGG1 3. Starting from the start codon, what is the third amino acid incorporated into the polynantide chaina O1. Cys Met Glu IV. Gly Third letter UCAG UCAG UCAG UCAG C. A. First letter
- ic ons ue Qu Que CH₂OH H/ HO 업 H € . 1 6 6 6 6 6 6 6 H H₂N-C-C Yo CH₂ 6 6 6 6 6 SH O O CH₂ CH CH₂ сос-о CH₂ CH₂ CH₂ OH OH CH₂ NICH₂ CH₂ 0 oooooo OH 15. CH₂OH HO OH H₂N* C-C CH₂ CH₂ CH₂ CH₂OH OH H 0- OH OH H HTC OH HỘ CH HO C-H H-C-OH H-C OH H H X÷L N OH H₂C HOCH, O OH OH OH CH₂ H MATCH IMAGES on the LEFT with the Appropriate Groups of molecules listed below (more than one may apply) A. Fatty acid/Lipid B. Phospholipid in plasma membrane C. Carbohydrate D. Amino Acid E. Phosphate F. Cis Isomer Ca G. Monosacharide H. DisacharideP(A-a)O2 rangesesc A ALEKS-Julianna Graham - L x 5 Grades for Julianna Graham: C www-awu.aleks.com/alekscgi/x/Isl.exe/10_u-IgNslkr7j8P3JH-IQUHIQg6bJxmeSyVPHOEB1plef9xyC5Ca9QIC2eximg311f4UgzRAfAESBjuj6RDc7Yrn... Biological Macromolecules New Chrome available: 0/5 Julianna Naming and drawing cyclic monosaccharides Give the complete common name, including anomer and stereochemistry labels, of the following molecules. You will find helpful information in the ALEKS Data resource. H H CH₂OH 0 OH OH OH OH H OH OH HOCH₂ OH H H H OH H H носна H OH OH HOCH2 CH₂OH H H OH OH OH Explanation Check 0 80 800 F4 F3 # $ % Λ α ẞ Y 5 MacBook Air F6 & F7 olo 2024 McGraw Hill LLC. All Rights Reserved. Terms of Use | Privacy Center Accessibility * F10 F12 dele
- C UUU UUC Phe UUA UCU) UCC UCA UAU UAC Tyr UGU UGC Cys Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUG FLeu UCG CUU CUC CCU] СС CAU1 CAC САC His САА Gln CGU CGC Arg Leu Pro CUA CUG ССА CGA CUG J CCGJ Which of the following tRNA anticodons could theoretically base pair effectively with the codons 5'-AAU-3' and 5'-AAC-3' through third-base CAG, CGG AGU AAUASN AGC AUU AUC File A AUA ACU АСС АСА AAC FAsn AAA Ser C Thr AGA Arg A AUG Met ACG AAG Lys AGG GCU] GCC GCA GCG GGU GGC Gly GGA GAU1 GUU GUC GUA GUG Asp GACJ GAA C Val Ala A GAG Glu GGG wobble? 5'-GGG-3' OI. 5'-AUG-3' II. 5'-GUU-3' I. 5'-CAT-3' IV. 5'-AAA-3 V. Third letter UCAG UUAG A, First letterA ALEKS - Julianna Graham - Lex ← -> C + www-awu.aleks.com/alekscgi/x/Isl.exe/10_u-lgNslkr7j8P3JH-IQUHIQg6bJxmeSyVPHOEB1plef9xyC5Ca9QIC2eximg3llf4UgzRAfAEs Bjuj6RDc7Yrn0JQE5NIn-2CENI_Mk.... Biological Macromolecules Classifying mutations A certain section of the coding (sense) strand of some DNA looks like this: ATGAGGTTATAG It's known that a very small gene is contained in this section. In the table below, write the base sequence for two point mutations of this DNA, one silent, and one not. Silent mutation: Non-silent mutation: Explanation Check MacBook Air 0/5 Julianna 5 ala 2024 McGraw Hill LLC. All Rights Reserved. Terms of Use Privacy Center | Accessibility ΣThis dipeptide is designated as: H3N-CH-C-NH-CH-C ČH2 CH2 OH SH O Ser-Lys O Lys-Ser O Ser-Cys O Cys-Ser 1 pts
- Second letter U A G UUU Phe UUC, U UUA UCU) UCC UCA UAU UAC FTyr UGU] UGCCYS UUG FLeu UCG, Ser UAA Stop UGA Stop A UAG Stop UGG Trp G CAU 1 CGU CGC Arg CUU CCU His CÁC S САА CỤC ССС Leu Pro CỦA ССА CGA CUG CCG CAG GIn CGG AAU LAsn AGU ], AUU ACU* AUC }ile A AUA АСC АСА ААС AAA Ser AGC. AGA Thr JArg AUG Met ACG AAG FLys AGG GAU ASP GACS GAA GAGJ Giu GGG) GUU GUC - Val GUA GCU] GCC GGU GGC Ala Gly GCA GGA Glu GUG GCG Given the double-stranded DNA molecule shown below, what is the sequence of the mRNA corresponding to the coding strand (the one that would be made by RNA polymerase reading the template strand). Label the 5' and 3' termini. Coding strand 5'- ТАTGAAАTTTAAATTT -3' Template strand 3'- АТАСТТТАААТТТАAA — 5' а. What are the amino acid sequences encoded peptides by the three possible reading frames? Please write your answer like this: Pro-His-Stop-Leu etc. Reading frame 1 starts with the first 5' nucleotide. ORF1: Enter your answer here ORF2: Enter your answer here ORF3: Enter…1 10 20 30 40 50 60 70 -I---- 5' АTCGGTCТCGGCTACTACАТАAАСGCGCGCATATATCGAТАТСТАGСТАGСТАТCGGTCTAGGCTACTАC 3' TAGCCAGAGCCGATGATGTATTTGCGCGCGTATATAGCTATAGATCGATCGATAGCCAGATCCGATGATG I--------I--- --I--- --I------ --I--- -I---------I Promoter 80 90 100 110 120 130 140 -I---- 5' CAGGTATсGGTCTGATCTAССТAGCTTCTтсттстстстстсссссGCGGGGGCTGTACTATСATGCGTCG 3' GTCCATAGCCAGACTAGATCGATCGAAGAGAAGAGAGAGAGGGGGCGCCCCCGACATGATAGTACGCAGC -I- -I------- -I--- -I---------I RBS 150 160 170 180 190 200 210 -----I--- ---I-- ------I- ---I---------I---- -I---------I 5' тстCGGCTАСТАCGTAAACGCGCGCATATAтCGATATCTAGCТAGСТАТСGGTстCGGCTACTAсGTAAA 3' AGAGCCGATGATGCATTTGCGCGCGTATATAGCTATAGATCGATCGATAGCCAGAGCCGATGATGCATTT 220 230 240 250 --I----- ---I-- ------I--- -I 5' CCCTATTAGCATGGGTCATATTTGTGTCTGCTTGTTGGGT 3' GGGATAATCGTACCCAGTAGAAACACAGACGAAGAACCCA a. What are the nucleotides of the MRNA from gene Z? b. What are the amino acids encoded by gene Z? ( Vate VHindII --- 5' GTC - GAC 3', HaeIII --- 5' CC - GG 3', EcoRI --- 5' G - AATTC 3' and BamI --- 5' CCTAG - G 3' 5' AGAATTCTTACGCCGGACGTACCTAGGTTTAGTCGACTC CGCCGCCCCTAGGGTCATCA 3' 3' TCTTAAGAATGCGGCCTGCATGGATCCAAATCAGCTGAGGCGGCGGGGATCCCAGTAGT 5' Number of pieces of DNA , and blunt end fragment (s), and sticky end fragment(s)
