As we focused on the translation of mRNA into proteins as well as on protein structure and function. Along the way, we found many opportunities to consider the methods and reasoning by which much of this informationwas acquired. From the explanations given in the chapter,what answers would you propose to the following fundamentalquestion What experimental information verifies that certain codonsin mRNA specify chain termination during translation?

Q: Briefly explain the importance of the protein factor EF-Ts in the translation process. Do not simply…

A: After the process of transcription of DNA to RNA in the nucleus of the cell, ribosomes in the…

Q: In eukaryotic cells, secreted proteins are initially directed to the endoplasmic reticulum and then…

A: Introduction The secretory pathway refers to the endoplasmic reticulum, Golgi apparatus and the…

Q: Linezolid is a new type of antibiotic that inhibits protein synthesis in several bacterial species…

A: Linezolid is an antibacterial drug used to treat infections caused by resistant strains of…

Q: Post-translational modification of proteins refers to the covalent and  enzymatic modification of…

A: The translation is a process by which the proteins are synthesized from the RNA. RNA polymerase and…

Q: what percentage of the total amino acids in the protein would be made up of proline (Pro)?

A: Proline is an amino acid codded by the codons CCG, CCC, CCU, and CCA. Any one of these codons can…

Q: a. In your claim words, depict the contrast between ρ-dependent and ρ-independent end of translation…

A: ρ-dependent is basically a translation termination mechanism occuring in prokaryotic cells. Here ρ…

Q: Pompe disease is a rare genetic condition resulting from a deficiency of the protein…

A: Pompe disease is a genetic disorder that involves the accumulation of glycogen inside the cells.…

Q: What experimentally derived information led to Holley’s proposal of the two-dimensional cloverleaf…

A: Introduction:  The structure of tRNA was first elucidated by Holley for the amino acid alanine. Its…

Q: Christian Anfinsen showed that the enzyme Ribonuclease (RNase) is completely inactivated at high…

A: In the 1950s, Christian Anfinsen performed a series of studies. He discovered that all the…

Q: A group of researchers isolate 'Protein X' from the wall of a human stomach with the intent of…

A: The protein is an extremely complex substance which consist of amino acid residues jointed by…

Q: During planetary exploration a new life form is discovered which has a DNA genome containing 6…

A: Nucleus is the genetic centre of the cell. It contains hereditary and genetic information stored in…

Q: A synthetic mRNA added to a cell-free protein-synthesizing system produces a peptide with the…

A: Translation is the process of formation of protein using the information encoded in the mRNA. mRNA…

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: Consider the following in light of the concept of levels of structure (primary, secondary, tertiary,…

A: In double stranded DNA structure two strands run in anti-parallel directions through base pairing…

Q: In EUKARYOTIC translation, how does initiation of translation occur? a) What components of the…

A: The process of decoding the genetic information carried by mRNA molecules in order to synthesize…

Q: Would a chimeric translation system containing thelarge ribosomal subunit from E. coli and the small…

A: The chimeric translation system is the translation process that uses two different ribosomal…

Q: Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…

A: An exon is any part of a gene that will encode a part of the final mature RNA produced by that gene…

Q: Polycistronic mRNA are common in bacteria but seldom occur in eukaryotes. Describe the key…

A: mRNA which stands for messenger RNA is a molecule responsible for production of amino acid chain…

Q: Explain briefly how translation is initiated from a) prokaryotic mRNA and b) eukaryotic mRNA.…

A: The translation is the process of using the genetic information in mRNA to create a protein. In the…

Q: One single polypeptide chain  (120 amino acid residues) is produced for protein A in prokaryotic…

A: A polypeptide chain is a linear or cyclic  compounds which have amino acids as the building units of…

Q: As we focused on the translation of mRNA into proteins as well as on protein structure and function.…

A: One gene one enzyme hypothesis, proposed by Beadle and Tatum, says that each enzyme produces a…

Q: 2a) In prokaryotes, a small ribosomal subunit can potentially get on an mRNA anywhere it can find…

A: The translation is the process of polymerization of amino acids to form polypeptides or protein. It…

Q: Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which…

A: CF is caused by a mutation in a gene called the cystic fibrosis transmembrane conductance regulator…

Q: As we focused on the genetic code and the transcription of genetic information stored in DNA into…

A: BASIC INFORMATION  GENETIC CODE  The genetic code term was coined by George Gamow. There are total…

Q: ist several ways in which eukaryotic messenger RNA differs from prokaryotic mRNA.

A: messenger RNA or m RNA is the RNA formed during the transcription process from DNA. The enzyme used…

Q: Assume that the translational error frequency, δ, is 1 x 10–4.(a) Calculate the probability of…

A: mRNAs are used to form protein by translation. The translation is performed using ribosomes, t-RNA…

Q: The ribonucleotides C and G we're mixed together with C two times more abundant than G. The…

A: Introduction: The synthesis of a protein or a polypeptide chain in a living cell is known as…

Q: The antibacterial protein colicin E3 is an effective inhibitor of pro- tein synthesis in…

A: It is given that the protein colicin E13 is an effective inhibitor of the protein synthesis in…

Q: As we focused on the translation of mRNA into proteins as well as on protein structure and function.…

A: tRNA : It is an adaptor molecule composed of RNA, typically 76 to 90 nucleotides in length, that…

Q: Explain how a peptide bond is formed in translation elongation in terms of: a) Which enzyme…

A: Introduction  Peptide bonds are covalent bonds that link two amino acids together to form a peptide…

Q: All eukaryotes possess a surveillance pathway referred to asnon-sense-mediated mRNA decay (NMD). Its…

A: There is a great importance of start codon and stop codon in the process of translation. The…

Q: Given the following sequence of a coding DNA strand: AGTTGCGCATGCCAGAGAGGTTCGAGTGCACATAACTTGAG The…

A: DNA is a double stranded molecule with coding strand and template strand. Template strand is the one…

Q: RNA helicases are a class of proteins that bind mRNAs and influence their secondary structures and…

A: RNA helicase enzymes belong to a class of proteins that bind mRNAs and influence their secondary…

Q: To become functional, newly synthesized RNA must undergo a series of maturation steps such as…

A: According to the central dogma of molecular biology, the information stored in the DNA is first…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.