All eukaryotes possess a surveillance pathway referred to asnon-sense-mediated mRNA decay (NMD). Its principalfunction is to eliminate mRNA transcripts with prematurestop codons. Such faulty transcripts are detected duringtranslation and subsequently destroyed by removal of the 5′cap followed by degradation by a nuclease. Describe howpremature stop codons are detected and what type of errorcauses them.

All eukaryotes possess a surveillance pathway referred to asnon-sense-mediated mRNA decay (NMD). Its principalfunction is to eliminate mRNA transcripts with prematurestop codons. Such faulty transcripts are detected duringtranslation and subsequently destroyed by removal of the 5′cap followed by degradation by a nuclease. Describe howpremature stop codons are detected and what type of errorcauses them.

Name: All eukaryotes possess a surveillance pathway referred to asnon-sense-
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: All eukaryotes possess a surveillance pathway referred to asnon-sense-mediated mRNA decay (NMD). Its principalfunction is to eliminate mRNA transcripts with prematurestop codons. Such faulty transcripts are detected duringtranslation and subsequently

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter14: Gene Regulation

Section14.3: Gene Regulation In Eukaryotic Cells

Problem 10LO

See similar textbooks

Similar questions

Consider the now dominant variant of the SARS-CoV-2 called the D614G mutation: a) The mutation changes an Aspartate (D, Asp) to a Glycine (G, Gly) at nucleotide position 614 (that’s why it’s called the D614G mutant) in the S1 subunit of the Spike protein. Using only the information above and a codon table, what are the mRNA codon sequences of the 2019-dominant and 2020-dominant Spike proteins? Note the figure above is not needed toanswer the question. Report in 5’ to 3' orientation __________________________________________ b) What type of substitution is this? In your answer, address the following: • The expected substitution in base sequence (e.g., A à C)• If the mutation is synonymous, nonsynonymous, or a frameshift• If the mutation is a transition or a transversion c) The mutation increases infectivity by reducing the stability of the Spike protein such that it can remain in the open conformation more often. The open conformation increases the chances of binding to the host ACE2…
Many uridine molecules are inserted into some mitochondrial mRNAs in trypanosomes. The uridine residues come from the poly(U) tail of a donor strand. Nucleoside triphosphates do not participate in this reaction. Propose a reaction mechanism that accounts for these findings. (Hint: Relate RNA editing to RNA splicing.)
The following four mutations have been discovered in a gene that has more than 60 exons and encodes a very large protein of 2532 amino acids. Indicate which mutation would likely cause a detectable change in the size of the mRNA and/or the size of the protein product. Consider a detectable change to be >10% of the wild-type size. A table of the genetic code is shown below. First letter 0 00 U O A บบบ UUC UUA UUG U CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu >Leu AUU AUC lle AUA AUG Met >Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Second letter C Ser Pro Thr Ala CAU CAC CAA CAG UAU UGU Tyr UAC UGC UAA Stop UGA UAG Stop UGG AAU AAC AAA AAG A GAU GAC GAA GAG His Gin Asn Lys Asp G Glu CGU CGC CGA CGGJ AGU AGC AGA AGG GGU GGC GGA GGG O AAG576UAG (changes codon 576 from AAG to UAG) Cys Stop Trp O GUG326AUG (changes codon 326 from GUG to AUG) Arg Ser Arg Gly DUAG DUA G DCAG DO AG deletion of codon 779 insertion of 1000 base pairs into the sixth intron (this particular…
All of the following are needed for capping of eukaryotic mRNA, EXCEPT Question 27 options: Guanylytransferase S-AdoMet RNA 5'-triphosphatase Adenosyl-transferase Methyl-transferase
The most common type of termination signal in E. Coli is a symmetrical inverted repeat of GC rich sequences followed by about 7 As that forms a stable stem-loop structure in the RNA, which disrupts its association with the DNA template and terminates transcription. true or false
Lactose permease is encoded by the lacY gene of the lac operon.Suppose a mutation occurred at codon 64 that changed the normalglycine codon into a valine codon. The mutant lactose permease isunable to function. However, a second mutation, which changescodon 50 from an alanine codon to a threonine codon, is able torestore function. Is each of the following terms appropriate or inappropriate to describe this second mutation?A. ReversionB. Intragenic suppressorC. Intergenic suppressorD. Missense mutation
Describe the prokaryotic translation initiation shown in the diagram. Define the convention of protein synthesis (directionality of synthesis) as well as the meaning of the A, P, and E sites of the ribosome.
If an antisense RNA is designed to silence the following mRNA sequence, which of the following antisense oligos (a-d) could be used for this purpose? mRNA sequence: 5' UAGGACUAUUAAGGUACACCCAUU 3' O 5' AUCCUGAUAAUUCCAUGUAAAUAA 3' O 5' AAUGGGUGUACCUUAAUAGUCCUA 3' O 5' UAGGACUAUUAAGGUACACCCAUU 3' O 5' UUACCCACAUGGAAUUAUCAGGAU 3¹
The eukaryotic cell is different from the prokaryotic cell. Outline the structural difference between these two types of cell and suggest two reasons why eukaryotic mRNA needs to be modified before translation.
Determine the amino acid sequence for a polypeptide coded for by the following mRNA transcript (written 5'-> 3'): AUGCCUGACUUUAAGUAG
As described earlier, DNA damage can cause deletion or insertion of base pairs. If a nucleotide base sequence of a coding region changes by any number of bases other than three base pairs, or multiples of 3, a frameshift mutation occurs. Depending on the location of the sequence change, such mutations can have serious effects. The following synthetic mRNA sequence codes for the beginning of a polypeptide: 5′-AUGUCUCCUACUGCUGACGAGGGAAGGAGGUGGCUUAUC-AUGUUU-3′ First, determine the amino acid sequence of the polypeptide. Then determine the types of mutation that have occurred in the following altered mRNA segments. What effect do these mutations have on the polypeptide products? a. 5′-AUGUCUCCUACUUGCUGACGAGGGAAGGAGGUGGCUUAUCA-UGUUU-3′ b. 5′-AUGUCUCCUACUGCUGACGAGGGAGGAGGUGGCUUAUCAU-GUUU-3′ c. 5′-AUGUCUCCUACUGCUGACGAGGGAAGGAGGUGGCCCUUAUC-AUGUUU-3′ d. 5′-AUGUCUCCUACUGCUGACGGAAGGAGGUGGCUUAUCAU-GUUU-3′
The following enzyme has an exact integer number of turns. What is the length and amount of amino acid? And based on the image, what post-translational modification it has undergone?