9. Calculate the hourly rate of heparin in mL/hr. 40,000 units of heparin in 1000 mL of Normal Saline infusing at 1300 units/hr. 10. Calculate the hourly dose of heparin in units/hr. 30,000 units of heparin in 500mL of D5W infusing at 24 mL/hr.

9. Calculate the hourly rate of heparin in mL/hr. 40,000 units of heparin in 1000 mL of Normal Saline infusing at 1300 units/hr. 10. Calculate the hourly dose of heparin in units/hr. 30,000 units of heparin in 500mL of D5W infusing at 24 mL/hr.

Phlebotomy Essentials

6th Edition

ISBN:9781451194524

Author:Ruth McCall, Cathee M. Tankersley MT(ASCP)

Publisher:Ruth McCall, Cathee M. Tankersley MT(ASCP)

Chapter1: Phlebotomy: Past And Present And The Healthcare Setting

Section: Chapter Questions

Problem 1SRQ

See similar textbooks

Related questions

Q: Question 17 A male patient is receiving heparin by continuous intravenous infusion. The nurse will…

A: Medicine now is radically different from what it has previously been in our history and culture. We…

Q: This lab examines the relationship between the absorbance of light by a solution at 595 nm and the…

A: Bovine serum albumin or BSA is a serum albumin protein derived from cows. It is often used as a…

Q: When using the SSO in the BCBS Plan, the is instructed by the BCBS Plar A Hospital Patient Surgeon A…

A: There are a number of health insurance plans are there, which all pays the cost of health care…

Q: Question 17 You have pethidine injection 100 mg in 2 mL. The patient is prescribed 75 mg. How much…

A: To administer 75 mg of pethidine using an injection containing 100 mg in 2 mL, we'll calculate the…

Q: The Whittaker classification is based upon all of the following EXCEPT A level of organization B…

A: R.H Whittaker proposed a five kingdom classification; Kingdom Monera Kingdom Protista Kingdom Fungi…

Q: QUESTION 38 What is the source of the following ions in the ocean. lons Source Sodium and magnesium…

A: The two ions that are present most often in seawater are chloride and sodium. These two make up over…

Q: For a successful direct staining, one should A. use a minimal amount of water to speed up the…

A: Direct staining is the process to make slides using a single stain or dye.

Q: QUESTION 8 Consider the pathway for the synthesis of the amino acid arginine in Neurospora: ARG-E…

A: The mutation in a particular gene that produce an enzyme for a metabolic process will affect the…

Q: Question 15 Cooking greatly increases the antioxidant lycopene in tomatoes. O True O False

A: Lycopene is an antioxidant found in tomatoes

Q: QUESTION 11 Place the following steps in the when renin-angiotensin-aldosterone system (RAAS) that…

A: Blood pressure is the pressure that can be felt against arterial walls that are caused by the…

Q: Question #3 Describe the general concept of trade-offs between virulence and transmission, and give…

A: Microbes, which are tiny and nearly invisible, have had a huge influence on society since the…

Q: Question 18 (1 point) A test tube is known to have simple sugars. The solution is blue after the…

A: Benedict's test is used to test the simple carbohydrates (sugars). It is used to differentiate the…

Q: At all concentrations angiotensin II causes antinatriuresis and antidiuresis by: OA. Decreasing the…

A: The correct option for this question is option A Angiotensin is a water conserving agent that act on…

Q: MSA/mannitol salt agar plate is selective because: O it allows only gram positive bacteria to grow O…

A: Mannitol salt agar(MSA) It is a selective medium used for the isolation, enumeration and…

Q: QUESTION 1 The "gel" in "gel electrophoresis" is a material that is considered liquid solid…

A: Note- According to our guidelines, we are supposed to answer only one question. Please repost the…

Q: B.1.351 is a variant of SARS-CoV-2. It has the amino acid substitution N501Y in the spike protein on…

A: The aromatic amino acids like Tyrosine, tryptophan and phenylalanine absorb ultraviolet light. The…

Q: Question 28 Imagine that vou are working in a lab studying the SARS-Cov-2 virus and you are trying…

A: RNase enzyme digests the RNA molecules. DNase digests the DNA molecules. Protease digests the…

Q: QUESTION 26 The creation of knockout (or knockin) mice involves all but one of the following O A.…

A: Knockout mouse It is defined as the genetically modified mouse which has its existing gene…

Q: An antibody (Ab) can bìnd to its antigen binding site (B) with a high affinity (large negative AG°).…

A: The antibodies bind to its antigen via non n covalent interactions like hydrogen bonding,…

Q: Following a concussion, we see a large influx of:

A: A concussion is very severe disease. It one type of head injury which is temporarily affects brain…

Q: Question 14 Friedreich's ataxia is a rare inherited disease that causes nervous system damage and…

A: Tests that may help diagnose Friedreich's ataxia include nerve conduction studies, tests of heart…

Q: In making an artificial cell, the plasma membrane is represented by ____________ _____________.

A: Artificial cell is that synthetic arrangement of particles which together mimics an actual…

Q: QUESTION 3 3.1 Following the recent cholera outbreak in Hammanskraal, a town in the Northern…

A: A disease is a deviation from the normal structure or functioning of an organism resulting in…

Q: Question 3. Eukaryote cells are living cells that are specialized to deal with changes in the…

A: The immune system checks the body for infections or problem-causing chemicals and fights any harmful…

Q: Enzymes, proteins and deoxyribonucleic acid (DNA) are important biological macromolecules. Enzymes…

A: Protein folding is a vital phenomenon happening in the living world. Folding includes biology,…

Q: what type of inhibition is shown and where does the inhibitor bind to the enzyme?

A: Enzymes are usually protein molecules which catalyzes the biochemical reaction by decreasing the…

Q: QUESTION 37 A reservoir is O an environment that may contain various pathogenic microbes. O a living…

A: Introduction :- All living and non-living objects that occur naturally, or in this example, without…

Q: QUESTION 14 Match pairs of terms together that have the same value b. 1 micromole 1 μmole/l 1 mM 1…

A: 0.1 = 10-1 (deci)0.01 = 10-2 (centi) 0.001 = 10-3 (milli) 0.000 001 = 10-6 (micro)0.000 000 001 =…

Q: QUESTION 14 1. As you walk through the Reading Terminal, you browse one of the fish stands. You see…

A: The main distinguishing feature of bony fishes is the that their skeleton is made of true bone and…

Q: o isolate DNA from cells, you must disrupt the cell Therefore, you treated your cells with a lysis…

A: Cell lysis or cell disturbance is a strategy wherein the external limit or cell film is separated or…

Q: QUESTION 9 In our walk-through of the HIV ELISA in zoom class, we were doing a test used to diagnose…

A: ELISA stands for Enzyme Linked Immunosorbent Assay. It is a common laboratory method in molecular…

Q: You have a 20% stock of NaCl, a 30% stack of KHPO, 2.5 M NH CI and 10 mg/ml stock of ampicill a. How…

A: The total number of shares that are literally listed (bought and sold) throughout the business day…

Q: Question 15 of 20 The physician orders digoxin tablets 187.5 mcg PO daily for the patient. How many…

A: Question is related to drug calculation Solution given below steps

Q: The following molecules are separated using size exclusion chromatography. Give an order in which…

A: Size exclusion chromatography (SEC), also known as gel filtration, gel permeation, molecular sieve,…

Q: The metabolic reaction pathway that is responsible for the generation of the most reducing…

A: Metabolic pathways are the series of chemical reactions that occur in the cells which synthesize and…

Q: DNA positively supercoils during replication and negatively supercoils in transcription.

A: Transcription is a process where DNA replicate into RNA, while replication is the making of DNA…

Q: Question 17 The genetic code in unambigous that means many codons can code for the same amino acids.…

A: Answer : The genetic code in unambiguous that means that codons can code for the same amino acids .…

Q: Aconitase catalyzes the conversion of Citrate to Isocitrate in the TCA cycle. The standard free…

A: The free energy of a reactionat nonstandard conditions can be determined using ΔG = ΔG⁰ + RT ln Q.…

Q: d. 13.6 mL 23. The dose of deferiprone in treating iron overdose is 75 mg/kg/day given in three…

A: Drug dosage calculations are the most basic in pharmacology for nurses. It is essential to know some…

Q: The bonds linking bases and sugars are covalent. A) True B False

A: DNA and RNA are nucleic acids which are polymers formed by monomeric subunits called nucleotides and…

Q: Question 14 Friedreich's ataxia is a rare inherited disease that causes nervous system damage and…

A: Friedreich ataxia is a genetic condition that affects the nervous system and causes movement…

Q: Diabetes mellitus possesses a serious health challenge worldwide and there has been an increased…

A: Through self-monitoring of blood glucose, a patient can monitor its own blood.

Q: Question 4 Temoporfin (Foscan) is a photosensitizer used in photodynamic therapy for the treatment…

A: Introduction:- Temoporfin, a second-generation photo ensitizer from the chlorin family, has a…

Q: QUESTION 47 Refer to the table below, which summarizes conditions used in four experiments in which…

A: Photosynthesis is a process in which Photosynthetic organsims carrying Photosynthetic pigments are…

Q: QUESTION 5 You plan to run a standard curve of BSA to determine the concentration of protein in an…

A: Step 1:Step 2:Step 3: Hope this helps!

Q: QUESTION NO. 1 Cystic fibrosis is a frequent generic disease of Caucasians. The CF gene codes for a…

A: Chaperones are a group of proteins that have functional similarity and help in protein folding. They…

Question

Can you please answer these two sub questions and show all of the steps to the solution

9. Calculate the hourly rate of heparin in mL/hr. 40,000
units of heparin in 1000 mL of Normal Saline infusing at
1300 units/hr.
10. Calculate the hourly dose of heparin in units/hr.
30,000 units of heparin in 500mL of D5W infusing at 24
mL/hr.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

Question 12 Repulsion between phosphate groups keeps the strands a uniform distance apart. (A) True B False
Question 64 The software program "foldit", which allows you to design your own molecules, is an example of an: in vivo assay O in vitro assay O in silico assay
QUESTION 50 Frederick the Great believed that this drug would make his soldiers unfit to fight a war: O coffee O beer O cannabis O tobacco Ick Save and Submit to save and submit. Click Save All Answers to save all answers. NA here to search
QUESTION 19 In using a Bradford reagent to measure protein concentrations, a protein sample is diluted 100x then diluted 100x again. The concentration of the diluted sample is found to be 0.605 mg/ml. How much the undiluted sample and buffer in volume (microliter, ul) are needed to create a 1 ml solution containing the protein at 2 mg/ml concentration? O 2 ul protein | 998 ul buffer O 49 ul protein | 951 ul buffer O 40 ul protein | 960 ul buffer O 20 ul protein | 980 ul buffer
Question:- The enzyme aromatase is found in the cytoplasm of some cells and converts testosterone to estrogen. You decide to test aromatase from a particular cell, and oops, your lab partner admits he drastically increased the pH in all the test tubes. Which of the following is a likely result? a. The enzyme will be denatured and the substrate will not bind to the active site. b. The enzyme will convert testosterone to estrogen at a faster rate. c. The mistake will have no effect on the experiment, because enzymes are not sensitive to pH. d. The free energy will be lowered and the reaction will not proceed spontaneously.
Question 28
QUESTION 1 [20]On the 9th August 2021, a confirmed case of Marburg virus was identified in south-western Guinea.As an epidemiologist sent to the region, describe the steps you would take in investigating theoutbreak, including the measures you may recommend to prevent further spread of the virus.
Question 43 Nucleotide triphosphates and nucleotide diphosphates often form stable complexes with Na Fe3 Mg2 K* Question 46
Question 15 of 17 Fill in the blanks: is the wavelength in nanometer used in spectrophotometric estimation of proteins is a catalyst used in Kjeldahl Method is an amino acid responsible for uv absorption of proteins is the word that stands for "I" in ELISA is the active component present in Lowry's Reagent
Question 7: A. Calculate how to make 10 ml of a 7.5% methylene blue stock solution (from solid powder). B. Calculate how to make a series of 1:10 dilutions of this stock. Imagine you'll use 5 ml of each dilution for your experiment. Calculate the final concentrations of each tube. tube 1: take some stock, dilute it 1:10 with some water in a new tube - #1 tube 2: take some of #1, dilute it 1:10 with some water in a new tube tube 3: take some of #2, dilute it 1:10 with some water in a new tube tube 4: take some of #3, dilute it 1:10 with some water in a new tube C. First, decide the total volume to make of each tube-keep in mind measurement accuracy (consider preparing 20% more solution than what you will use). D. Then, calculate how much stock, water and final concentration of each. E. Then, instead of doing a serial dilution, calculate making each of the above solutions using the weight/volume % solution method. F. Compare and contrast serial dilution and W/V % methods
Question 1 Please take the following sequence of DNA and perform 1) DNA Synthesis, 2) Transcription, and 3) Translation in that order. The sequence you get after doing DNA synthesis use for doing Transcription. The sequence you get from transcription use for doing translation. CCATGTTCCTCACCGGGCTATTCAATAAATAAC Answer = 1) ___________________________________________________ 2) ___________________________________________________ 3) ___________________________________________________ asap
QUESTION 19 Match each of the following hormones to its function. aldosterone angiotensin II atrial natriuretic hormone antidiuretic hormone A. stimulates the kidneys to secrete Na+ ions (water follows by osmosis); stimulates the reabsorption of K+ ions; inhibits the release of angiotensin II, aldosterone, and ADH. B. stimulates the kidneys to reabsorb water; stimulates vasoconstriction of arterioles. C. stimulates kidneys to reabsorb Na* ions (water follows by osmosis) and to secrete K+ ions D. stimulates the kidneys to reabsorb Na* ions (water follows by osmosis); stimulates the release of aldosterone and ADH, stimulates the thirst center of the hypothalamus; stimulates vasoconstriction of arterioles, including the efferent arteriole