QUESTION 8Consider the pathway for the synthesis of the amino acid arginine in Neurospora:ARG-E→ citrullineARG-FARG-Hornithineargininosuccinate arginineMutant strains of Neurospora may carry one or more mutations. Neurospora mutant strain b is grown on minimal media plus supplements as shown.Growth is shown by (+) and no growth is shown by (o).Supplementsornithinemutant nothingcitrullinearginino-succinateargininestrainWhat can you conclude from these data?O Strain a has only one mutation and it is in ARG-E.O Strain b has only one mutation and it is in ARG-H.O Strain a has a mutation in ARG-F and strain b has a mutation in ARG-E.O Strain b has mutations in ARG-E, ARG-F, and ARG-H.+ +

The mutation in a particular gene that produce an enzyme for a metabolic process will affect the…

QUESTION 8 Consider the pathway for the synthesis of the amino acid arginine in Neurospora: ARG-E ARG-F ARG-H ornithine citrulline - argininosuccinate arginine -> Mutant strains of Neurospora may carry one or more mutations. Neurospora mutant strain b is grown on minimal media plus supplements as shown. Growth is shown by (+) and no growth is shown by (0). Supplements ornithine nothing citrulline arginino- mutant arginine strain succinate a What can you conclude from these data? O Strain a has only one mutation and it is in ARG-E. O Strain b has only one mutation and it is in ARG-H O Strain a has a mutation in ARG-F and strain b has a mutation in ARG-E O Strain b has mutations in ARG-E, ARG-F, and ARG-H.

QUESTION 8 Consider the pathway for the synthesis of the amino acid arginine in Neurospora: ARG-E ARG-F ARG-H ornithine citrulline - argininosuccinate arginine -> Mutant strains of Neurospora may carry one or more mutations. Neurospora mutant strain b is grown on minimal media plus supplements as shown. Growth is shown by (+) and no growth is shown by (0). Supplements ornithine nothing citrulline arginino- mutant arginine strain succinate a What can you conclude from these data? O Strain a has only one mutation and it is in ARG-E. O Strain b has only one mutation and it is in ARG-H O Strain a has a mutation in ARG-F and strain b has a mutation in ARG-E O Strain b has mutations in ARG-E, ARG-F, and ARG-H.

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

please help me with this question
Identify the open reading frame for the following sequence: CACAGCCTACTAATGGTGTTGGCTAT Note: When I first attempted this question I identified the open reading frame as starting from ATG. However I was told that my reading frame was wrong and that the frame should include an asparagine group but how it that possible?
The seed of the castor bean (Ricinus communis) contains large amounts of ricin, a deadly poison for animals, including humans. One of the two subunits of this toxin is a lectin that binds terminal N-acetylgalactosamine residues on glycoproteins on the surface of eukaryotic cells, allowing the other subunit to enter the cell and kill it by preventing proteins from being made. Select the possible antidotes that could prevent or reverse ricin-mediated entry of the toxin. a high concentration of N-acetylgalactosamine an oligosaccharide with the same structure as that recognized by ricin a compound that prevents synthesis of extracellular glycoproteins a compound that activates enzymes that break down glycogen into glucose an enzyme that degrades lipopolysaccharides
Neurospora crassa can synthesize the amino acid arginine from a precursor as follows: precursor ornithine citrulline arginine George Beadle and Edward Tatum identified various mutants (arg mutants) unable to synthesize arginine from this precursor. One such class (Class I) could synthesize arginine if either ornithine or citrulline was supplied. A second mutant class (Class II) could synthesize arginine if citrulline was added, but not if ornithine was added. A third class (Class III) could not synthesize arginine from either ornithine or citrulline. Which class or classes of arg mutants will grow on complete media?
1 2 Glycogenin is a homodimer of 37 kDa subunits. (Homodimer means identical subunits of type a that form a dimer of type a2). Glycogenin has a chain of a(1,4)-linked units of glucose attached to the sidechain of a tyrosine residue. The chain of a(1,4)-linked glucose units is a primer for the initiation of glycogen synthesis by glycogen synthase. Assume the dimer is stable and not in equilibrium with monomer subunits. Which of the answers below are plausible pathways for attaching or building the primer chain of glucose units? The branching enzyme attaches a chain of 7 glucose units to the tyrosine sidechain of glycogenin. 0 0 0 0 000 The transferase attaches 3 units of a(1,4)-linked glucose to the tyrosine sidechain of glycogenin. Glycogen synthase then extends the chain using UDP-Glc. 0 One glycogenin dimer builds the a(1,4)-llinked glucose chain on a subunit of another glycogenin dimer. -D-O Each subunit builds the a(1,4)-Ilinked glucose chain on the other subunit of the same dimer.…
Neurospora crassa can synthesize the amino acid arginine from a precursor as follows: precursor ornithine - citrulline arginine George Beadle and Edward Tatum identified various mutants (arg mutants) unable to synthesize arginine from this precursor. One such class (Class I) could synthesize arginine if either ornithine or citrulline was supplied. A second mutant class (Class II) could synthesize arginine if citrulline was added, but not if ornithine was added. A third class (Class II) could not synthesize arginine from either ornithine or citrulline. Which class or classes of arg mutants LACK a functional enzyme able to convert ornithine into citrulline?
True or false The disruption of the beta-lactamase gene causes resistance to the antibiotic pencillin
1) The plot to the right shows the Oxygen Saturation of Hemoglobin (Hb) versus O2 concentration. a) The Kd between HBa and HBB chains is 100 nM. When L35S mutation (Leucine 35 → Serine) is introduced into the Hba chain the Kd changes to 300 mm. \^^^^^A^A Draw a dashed curve on the figure to the right that represents how this mutation would likely change the curve. Note: that I am asking for how a change in affinity between HBa and HBB chains will impact HB binding to O2 1.00 0.75- HB Y 0.50 HBa L35S HBa L35S D101P 0.25 0.00 0 2 4 po₂ (kPa) 6 b) How might this specific mutation alter the interaction between HBa and HBB chains? I am asking you to predict what Leu specifically might be doing here. 8 c) Now imagine that a second mutation is added to the HB¤ L35S mutant to generate an HBa L35S D101P double mutant. A measure of the double mutant shows that it has a Kg = 2 kPa, but does not change the binding of HBa and HBB. Draw a dotted line on the figure above that shows the resulting…
Considerable effort has been directed toward determining the genes in which sequence variation contributes to the development of type 2 diabetes. Approximately 800 genes have been implicated. Propose an explanation for this observation.
The pathway for arginine biosynthesis in Neurospora crassa involves several enzymes that produce a series of intermediates as shown. O O O O ornithine citrulline ARG-E arginosuccinate arginine N-acetylornithine arginine You did a cross between ARG-E ARG-H* and ARG-E* ARG-H¯¯ Neurospora strains and identified an Arg- strain from an NPD tetrad. (Assume that Neurospora forms tetrads in the same way yeast do.) Which compound would rescue growth of this Arg- spore? N-aceltylornithine ARG-F ornithine citrulline ARG-G ARG-H → argininosuccinate
List two possible missense mutation effects on the new polypeptide.
Can you check if A is correct and please help answer the following questions?