8.Bacteria X contains the double stranded DNA sequence below. Our task is to design a labelled primer (probe) to detect this sequence. Which sequence below can be used for this task? Identify the single most correct answer below. * indicates a label 5' ATGCTTTTTTTAAACCCCGGGGTTTT 3' 3'TACGAAAAAATTTGGGGCCCCAAAA 5' a) 3' AATTTGGGGC* ( b) 3' ATGCTTTTTT* ( ) c) 5' TTTAAAGGG* 19 ( ) d) 5' ATGCTTTTTT* ) e) a and b () f) a and d 23 g) b and d 29.Ames assay is patented, so 2nd yr microbiology students devised a new assay where wild type GFP (green florescence protein AKA light producing) is used as the target gene, for mutation rate analysis. When compound A is added, even in very low concentrations, all colonies formed end up producing light (produce fluoresce). Therefore, one can conclude that compound A is a strong mutagen. () True False 30.The consensus SD (Shine/Dalgarno sequence) is 5' AGGAGGU. Identify the single most correct answer below. a) The SD sequence 3' AGGAGGU is stronger than the consensus SD sequence. b) The SD sequence: 5' AGGAGG is stronger than 5' AGGAG, which is stronger than 5' AGGA, in initiating transcription. ( c) The SD sequence: 5' AGGA is stronger than 5' AGGAG, which is stronger than 5 AGGAGG, in initiating transcription. d) None of the above
Bacterial Genomics
The study of the morphological, physiological, and evolutionary aspects of the bacterial genome is referred to as bacterial genomics. This subdisciplinary field aids in understanding how genes are assembled into genomes. Further, bacterial or microbial genomics has helped researchers in understanding the pathogenicity of bacteria and other microbes.
Transformation Experiment in Bacteria
In the discovery of genetic material, the experiment conducted by Frederick Griffith on Streptococcus pneumonia proved to be a stepping stone.
Plasmids and Vectors
The DNA molecule that exists in a circular shape and is smaller in size which is capable of its replication is called Plasmids. In other words, it is called extra-chromosomal plasmid DNA. Vectors are the molecule which is capable of carrying genetic material which can be transferred into another cell and further carry out replication and expression. Plasmids can act as vectors.
28.Bacteria X contains the double stranded DNA sequence below. Our task is to design a labelled primer (probe) to detect this sequence. Which sequence below can be used for this task? Identify the single most correct answer below. * indicates a label 5' ATGCTTTTTTTAAACCCCGGGGTTTT 3' 3'TACGAAAAAATTTGGGGCCCCAAAA 5'
a) 3' AATTTGGGGC*
( b) 3' ATGCTTTTTT* ( )
c) 5' TTTAAAGGG* 19 ( )
d) 5' ATGCTTTTTT* )
e) a and b ()
f) a and d 23
g) b and d
29.Ames assay is patented, so 2nd yr
() True
False
30.The consensus SD (Shine/Dalgarno sequence) is 5' AGGAGGU. Identify the single most correct answer below.
a) The SD sequence 3' AGGAGGU is stronger than the consensus SD sequence.
b) The SD sequence: 5' AGGAGG is stronger than 5' AGGAG, which is stronger than 5' AGGA, in initiating transcription.
( c) The SD sequence: 5' AGGA is stronger than 5' AGGAG, which is stronger than 5 AGGAGG, in initiating transcription.
d) None of the above

Step by step
Solved in 4 steps









