between the two restriction sites, how would the banding pattern on the gel differ from the one you drew in part a? (PART A WITH THE FIRST PART OF THE QUESTION IS ATTACHED)
Q: Which types of cells or cell components play an essential role in the blood clotting? Group of…
A: Blood clotting is a mechanism in which the liquid blood flowing out of the blood vessel due to the…
Q: Photosystem Primary electron acceptor Chlorophyll molecule Reaction center Light Stroma Thylakoid…
A: INTRODUCTION:- photosynthesis is defined as the formation of carbohydrates from CO2…
Q: Discuss the role adhesion proteins play in the formation of the neural system, neural crest cells,…
A: Introduction: During embryonic development, the formation of the neural system is a complex process…
Q: Cardiac muscle conducts myogenic signal in a manner similar to A) parasympathetic neurons B)…
A: Introduction A myocyte, also known as a muscle cell, is a specialized cell that forms the muscle…
Q: What is the purpose of the condenser? When using a petri dish, How do you label it? What side do you…
A: A Petri dish is a shallow transparent lidded dish used by biologists to hold growth medium in which…
Q: Prokaryotic organisms like bacteria use the flagella for movement. What is the basic structure of a…
A: Bacteria are unicellular microorganisms that are found in every environment on Earth. They can be…
Q: In a flower, Letter P for purple is dominant over p for white. What is the phenotype of a…
A: Introduction :- The terms phenotype and genotype are important in genetics. The genotype refers to…
Q: Which of the following is True about the STAT signaling cascade? O It amplifies signal for TGF-B…
A: Latent cytoplasmic transcription factors have been identified as STATs (signal transducers and…
Q: Myofiber,that is mature muscle cells, have more than one nucleus,how does that happen
A: Myofibers are units that form the skeletal muscles. They are seen as bundles, and apart from muscle…
Q: If mutations that alter EcoRI sites 1 and 2 occur in this piece of DNA, how will the banding pattern…
A: The gel electrophoresis is the method by which the DNA fragments are separated based on their sizes.…
Q: For whicj of the following problems would ICP-MS be appropriate. Explain why a) For the…
A: ICP-MS (Inductively Coupled Plasma Mass Spectrometry) is an analytical technique that can determine…
Q: A 0.10 M NaCl solution is (hypertonic/hypotonic/isotonic) to a 0.1M glucose solution.
A: Here is a table that summarizes the differences between isotonic, hypertonic, and hypotonic…
Q: What did Pasteur's results show? ► View Available Hint(s) When growth medium is not contaminated by…
A: Introduction Louis Pasteur is known for his contributions to microbiology, including his…
Q: U Question 5 A diffusely basophilic erythrocyte is a(n): O erythrocyte O polychromatic normoblast O…
A: Introduction Erythrocytes, also known as red blood cells (RBCs), are specialized cells in the blood…
Q: An increase in temperature will _______ transpiration. An increase in humidity will ______…
A: Transpiration is the process by which plants lose water vapor through the small pores on the surface…
Q: Part 1 Using a Table similar to the one below, compare the process of aerobic respiration with that…
A: Introduction Cellular respiration is the process by which cells in living organisms convert organic…
Q: TRUE OR FALSE 1. In culturing C. elegans, microorganisms like E. coli is used as their food and…
A: C. elegans: A translucent, free-living nematode with a length of 1 mm that survives in temperate…
Q: Name and briefly describe three major contributions that Dr. DeBakey made to medicine and biomedical…
A: Dr. Michael DeBakey was a pioneering American heart surgeon and medical researcher who made numerous…
Q: What are the four types of macromolecules found in living organisms?
A: Introduction :- Macromolecules are large molecules that are essential for life processes in living…
Q: Use correct sig figs The concentration of a purified monoclonal antibody was measured using UV280…
A: Monoclonal antibodies are laboratory-produced molecules that are engineered to mimic the immune…
Q: The function of Nutrient artery
A: Introduction Nutrition is the process by which the body obtains and utilizes nutrients from food in…
Q: Hui fell and twisted their ankle while playing basketball. It is painful, swollen, and red. Based on…
A: Introduction :- Inflammation is a biological response of the body to harmful stimuli, such as…
Q: Which of the following does not describe a gene? A. A gene is the observable characteristics or…
A: DNA also called as deoxyribonuclei acid is the most important part of an individual that maintains…
Q: The sugar produced during photosynthesis is _________ Select one: a. a polymer, cellulose b. a three…
A: Photosynthesis is a process mainly exhibited by green plants or photoautotrophs to prepare their own…
Q: Describe how cardiac performance is measured in cardiac output. In your answer, be sure to describe…
A: Cardiac performance is commonly measured by the cardiac output, which is the amount of blood pumped…
Q: Topic related to eugenics/genetic testing/cloning etc
A: A fringe group of ideas and behaviours known as eugenics aims to enhance the genetic diversity of…
Q: Mytilus trossulus species of mussel lives in freshwater does this still mean that the water has a…
A: Introduction :- Mytilus trossulus is a species of mussel that is commonly found in both freshwater…
Q: Cladogram Worksheet Convert the following data table into a venn diagram, and then into a cladogram:…
A: Diagrams termed cladograms show the links between several taxonomic groups known as "clades."…
Q: Why do you think the auditory system has so many stages of processing before the signals reach the…
A: The visual system is a complex neural network that processes visual information from the eyes,…
Q: 3. Discussion/Analysis: a. How reliable are this week's results for each organism used? If you…
A: Introduction Gram staining is a laboratory technique used to differentiate bacterial species into…
Q: Will the bottleneck effect most likely increase or decrease the genetic variation of a population?…
A: Introduction :- The bottleneck effect is a phenomenon that occurs when a population undergoes a…
Q: Drug substances are useful based on their biological activity. Thus, an assay must be developed to…
A: Introduction Drug substances, also known as active pharmaceutical ingredients (APIs), are the…
Q: Cushing’s disease and Cushing’s syndrome both result in an excess amount of cortisol in the body,…
A: Both Cushing's disease and Cushing's syndrome can cause excess production of cortisol in the body,…
Q: do methodologies preparation of the following 6 solutions (Broth LB, LB Agar, Potato-Dextrose Agar,…
A: A gel or liquid that contains nutrients and is used to cultivate bacteria or other microorganisms is…
Q: 02. Let θ be the angle characterizing the change in direction of a filament along its length. For a…
A: The Worm-like model can be used to estimate the value of ⟨ θ^2 ⟩^1/2. This model describes the rod…
Q: Discuss with reference to the biological role of glucose and oxygen, the process of aerobic cellular…
A: Aerobic cellular respiration is a metabolic process that occurs in eukaryotic cells, which involves…
Q: order to increase nutrient uptake, plant roots will often exude ____ ions into the soil, which will…
A: Introduction: The pH of the soil impacts the nutrients that plants can use to thrive. While calcium,…
Q: 2. Complete the table below. Describe and differentiate the stages of Plasmodium in different…
A: Introduction:- Malaria is a potentially deadly disease caused by the Plasmodium parasite, which is…
Q: To achieve sustainable control of malaria in endemic areas, what approaches can you suggest to the…
A: The question asks for approaches that can be suggested to a community to achieve sustainable control…
Q: A heterozygous purple bird was crossed with a blue-feathered bird. One white-feathered offspring…
A: Two genes located on different chromosomes regulate the color of the feathers in birds. The lack of…
Q: The nucleolus manufactures RNA. Tues or False
A: Introduction RNA stands for ribonucleic acid. It is a type of nucleic acid that is essential for…
Q: Some plants and algae alternate between haploid and diploid generations. Match the ploidy to each…
A: Ploidy: The quantity of whole sets of chromosomes that make up a cell is known as its ploidy. Both…
Q: YY X XX XY Arrested primary oocyte Secondary oocyte after nondisjunction during meiosis I Mature…
A: Sex chromosomes are a pair of chromosomes that determine the sex of an individual. In humans,…
Q: When the ventricular walls contract A. the mitral valve opens, and the tricuspid valve closes. B.…
A: Introduction Ventricles are the two lower chambers of the heart, located below the atria. The heart…
Q: A diploid cell with three pairs of homologous chromosomes is shown on the left. Each letter…
A: Mitosis and meiosis are the two different types of cell division. Meiosis occurs in normal somatic…
Q: You have a culture of bacteria and you performed an Acid Fast staining. You see red rod-shaped…
A: Introduction - Acid-fast staining is a differential stainingused to differentiate acid fast and non…
Q: This element is essential but is not acquired via the roots. Select one: a. selenium b. zinc c.…
A: Introduction : Essential elements are those that have been confirmed to exist in all plants and are…
Q: For the diagram below, all of the following statements are true EXCEPT: Antigen- binding site V V…
A: Immunoglobulins (or antibodies) are produced by the immune system to fight pathogens like bacteria…
Q: Draw out the basic amino acid structure (not specific) What is a peptide bond?
A: Proteins Proteins are macromolecules that are made up of long chains of amino acids. They are…
Q: Question 1 If 100 uL is taken from the 10² dilution and added to 900 uL, what is the final dilution…
A: Colony-forming unit (CFU, cfu, or CFU) is a unit used in microbiology to measure the number of…
- If a 1000 bp of DNA were inserted between the two restriction sites, how would the banding pattern on the gel differ from the one you drew in part a?
(PART A WITH THE FIRST PART OF THE QUESTION IS ATTACHED)
Restriction sites are the special palindromic sequences present in DNA. These sites are the location for restriction enzymes which are kind of endonucleases that cut the DNA on these sites. So if a DNA has three restriction site then 4 fragments would be obtained.
Step by step
Solved in 2 steps with 1 images
- 4. A linear piece of DNA has the following EcoRI restriction sites. EcoRI site 1 2 kb 4 kb EcoRI site 2 5 kb a. This piece of DNA is cut by EcoRI, the resulting fragments are separated by gel electrophoresis, and the gel is stained with ethidium bromide. Draw a picture of the bands that will appear on the gel.1. What are restriction enzymes and what do they do? 2. Complete the chart Original DNA sequence 5' TGA CCA CTC GAG CAT AAC GAG TCG CTC 3° Write the complementary strand's sequence * remember it will be opposite directionality (the number at the ends are different) * pairs are A-T and C-G |Copy and paste your double stranded DNA into this box. You are going to use the restriction enzyme Xhol. Mark the cut site by changing the color (highlight or change text color) of one double-stranded piece * it cuts between the C and the T (cut shown as slash symbol): 5’ C/TC GAG 3' * remember it cuts BOTH strands (the restriction site is palindromic). Hint: read each strand in the 5'à 3' directions to find the cut site4. A linear fragment of DNA is exposed to a digest containing the individual restriction enzymes HindIII and Smal and then with a combination of the two enzymes. According to the gel electrophoresis results, the fragments obtained are Linear DNA HindIII Smal cut with: DNA HindIII + Smal 5.0 fragments 2.5 (kb) 5.5 3.0 2.0 2.5 2.0 a. Draw a map of the restriction sites on this linear piece of DNA. b. The mixture of fragments produced by the combined enzymes was then digested with the enzyme EcoRI. The results are fragments that are 2.5 kb, 2.0 kb and 1.5 kb. Add the restriction site for EcoRI on the map you created above.
- 5. Show the separation pattern of the following DNA molecules on an agarose gel electrophoresis. 5 kbp 5 kbp 5 kb 5 kbp ----8. You have a piece of DNA with the sequence shown below. 5-AAAGTCGCTGGAATTCACTGCATCCCCGGGGCTATATATGAATTCGATGCGTACTTGGCACG-3' 3'TTTCAGCGACCTTAAGTGACGTAGGGGCCCCGATATATACTTAAGCTACGCATGAACCGTGC-5' You cut this fragment with the restriction enzyme EcoRI. The recognition site for EcoRI is 5-GAATTC-3' 3-CTTAAGS" EcoRI cuts at the site and in the manner indicated by the arrows to yield fragments with overhanging ends. 3-СТТААG-5' 5'G AATTC-3' 3-СТТАА G-5' Draw an illustration showing how the piece of DNA is cut by EcoRI and how many fragments result. Show all the base pairs and the overhanging ends at the ends of the DNA fragments.12. You are working with a picce of DNA of the sequence: 5'-TATTGAGCTCCCCGGAT-3 3'-ATAACTCGAGGGGCCTA-5 You cut the above piece of DNA with a restriction enzyme that recognizes the sequence 5'GAGCTC and cuts on the 3' side of the A within this sequence. Please, draw all products that you get after digestion. Label all 5' and 3' ends.
- 25. The restriction enzymes Kpnl and Acc651 recognize and cleave the same 6-bp sequence. You have a plasmid and a linear DNA strand that both contain a Kpnl and Acc651 sequence in the same orientation as shown below. You digest both DNA pieces with both enzymes and then attempt to ligate the sticky ends, followed by treatment with DNA ligase. What will happen? 5' GGTACC3' 5' G G T ACC 3' 3' CCATGG 5' y CCATGGS Kpnl Acс651 A) You will produce sticky ends but the two types of ends will not ligate. Instead, you may produce a small amount of religated plasmid where the digested plasmid sequence re-inserts. B) You will produce a recombinant plasmid in which the linear DNA strand is ligated in between the two sites, suitable for cloning. C) You will produce blunt ends that will not ligate because the two restriction enzymes will both operate on both of the sites. D) All the DNA will be completely digested as if you had applied a general DNAse enzyme.3. A linear DNA fragment is cleaved with one, two or three restriction enzymes to yield fragments as follows: Enzyme(s) Fragments (kb) HindIII 2.5, 5.0 Smal 2.0, 5.5 HindIII + Smal 2.5, 3.0, 2.0 HindIII+ Smal+ EcoRI 1.5, 2.0, 2.5 Draw the restriction map of the original DNA fragment, indicating the positions of all restriction sites.2. A plasmid was digested with the enzymes BamHI, ECORI, and HindIII. A single digest was performed with each enzyme and then double digests were performed. Make a restriction map of the plasmid based on the data below and indicate the distances between the restriction sites Plasmid cut BamHI EcoRIHindIII EcoRI + EcoRI + ВатHI + with: DNA 87.2 fragments (bp) HindIII ВатHI HindIII 87.2 87.2 79.6 7.6 72.2 64.6 15 22.6
- 5. You wish to map restriction sites in an unknown plasmid that has not been sequenced. You digest the plasmid with combinations of EcoRI, SalI, and BamHI, producing fragment sizes as indicated in the table below. Draw a restriction map of the plasmid, indicating relative positions and distances between restriction sites. Restriction Enzyme(s) used | Resulting Fragment Sizes EcoRI 5386 Sall 5386 1079, 4307 3078, 2308 331, 1079, 3976 898, 1079, 3409 ВатHI EcoRI + Sall ЕcoRI + BamНІ Sall + BamHI13. Technique whereby inserting DNA into a clone is accomplished using two different restriction enzymes Group of answer choices Primer Walking Positional Cloning Directional Cloning Chromosome Walking7. Consider the following plasmid (size 6700 bp), with restriction sites at the positions indicated: BamHI + 1 6700 bp 2800 3500 EcoRI BamHI Probe