6. A portion of a gene is shown below. 5'-ATGATTCGCCTCGGGGCTCCCCAGTCGCTGGTGCTGCTGACGCTGCTCGTCG-3' 3'-TACTAAGCGGAGCCCCGAGGGGTCAGCGACCACGACGACTGCGACGAGCAGC-5' The sequence of the mRNA transcribed from this gene has the following sequence: 5'-AUGAUUCGCCUCGGGGCUCCCCAGUCGCUGGUGCUGCUGACGCUGCUCGUCG-3' a. Identify the coding and noncoding strands of the DNA. b. Explain why only the coding strands of DNA are commonly published in databanks.

6. A portion of a gene is shown below. 5'-ATGATTCGCCTCGGGGCTCCCCAGTCGCTGGTGCTGCTGACGCTGCTCGTCG-3' 3'-TACTAAGCGGAGCCCCGAGGGGTCAGCGACCACGACGACTGCGACGAGCAGC-5' The sequence of the mRNA transcribed from this gene has the following sequence: 5'-AUGAUUCGCCUCGGGGCUCCCCAGUCGCUGGUGCUGCUGACGCUGCUCGUCG-3' a. Identify the coding and noncoding strands of the DNA. b. Explain why only the coding strands of DNA are commonly published in databanks.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
17) Synthesis of the mRNA starts at the boxed A/T base pair indicated by the box and proceeds left to right on the sequence below. Transcribe and translate this bacterial gene. 5'-GGACCGCGGGGCAGGATTGCTCCGGGCTGTTTCATGACTIGICAGGTGGGATGACTTGGATGGAAAAGTAGAAGGTCATG-3 3'-CCTGGCGCCCCGTCCTAACGAGGCCCGACAAAGTACTGAACAGTCCACCCTACTGAACCTACCTTTTCATCTTCCAGTAC-5′ 1 -+--at - --+-- 80
The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are shown below. DNA sequence: 5’ - AGCATCTCATGTGCGAGTCCTGACGCTGACTAGC – 3’ 3’ - TCGTAGAGTACACGCTCAGGACTGCGACTGATCG – 5’ mature mRNA: 5’ – cap-AUCUCAUGUGCGAACGCUGACUAGAAAAAAAAAA- 3’ Draw boxes around any structures or bases that were added to the RNA during processing.
The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are shown below. DNA sequence: 5’ - AGCATCTCATGTGCGAGTCCTGACGCTGACTAGC – 3’ 3’ - TCGTAGAGTACACGCTCAGGACTGCGACTGATCG – 5’ mature mRNA: 5’ – cap-AUCUCAUGUGCGAACGCUGACUAGAAAAAAAAAA- 3’ In the DNA sequence, draw boxes around two exons in the gene. The splicing machinery does NOT pay attention to codons. The splicing of this DNA demonstrates that. How?
The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are shown below. DNA sequence: 5’ - AGCATCTCATGTGCGAGTCCTGACGCTGACTAGC – 3’ 3’ - TCGTAGAGTACACGCTCAGGACTGCGACTGATCG – 5’ mature mRNA: 5’ – cap-AUCUCAUGUGCGAACGCUGACUAGAAAAAAAAAA- 3’ How many amino acids are in the peptide encoded by the gene? _____________
The following bacterial DNA sequence uses the top strand as the coding strand and the bottom strand as the template strand. Write what the messenger RNA sequence for this gene would be after transcription occurs.
How many amino acid are in each of the two polypeptides produced? And how many nucleotides long would the final processed mRNA made from the gene be?
iii and iv
Consider the following mature mRNA from a human cell: 5' UAAUGUCGCAAUAACC 3¹ What is the sequence of amino acids in the translated protein? Second letter A First letter С U d A G บบบ UUC P U UUA UUG Leu CUU CUC CUA CUG GUU GUC GUA GUG -Phe Met-Ser-Gln Met-Arg-Lys-Ser Leu Stop-Cys-Arg-Asn-Asn C AUU AUC lle AUA ACA AUG Met ACG Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC GCU GCC GCA GCGJ Ser Pro Thr Ala UAU UAC Tyr UGU UGC. UAA Stop UGA Stop UAG Stop UGG Trp CAC CAGGin CAU His Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. AAU Asn AAA Lys AAG. There is no start codon, resulting in no translated protein. GAU ASP GAC Glu GAA GAG G CGU CGC CGA CGG Cys AGU AGC AGA AGG Arg GGU GGC GGA GGGJ Arg ser Gly MCAG U UCAG с А SCAG U SCAG U Third letter
3. For this gene (I marked the +1 site) a. Identify the promoter, template, and coding strand b. Transcribe Translate C. 5'- CAAATTAATGGCGGCATTTACGATGGTGGGATCATTACATTGACTAACG -3' 1 5 3'- GTTTAATTACCGCCGTAAATGCTACCACCCTAGTAATGTAACTGATTGC -5′ -+- -+--- --+−−· ---+--
3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’ 5’-AGAAGCACTCTACTATATTCTCAATAGGTCCATGGCCATTTGACC-3’ Write down the mRNA transcript from DNA above.
Answer the following whether it is TRUE or FALSE: 1. For each DNA segment 3'-ACCTGCCTACCCG-5' the sequence of the mRNA molecule synthesized is 5'-TGGACGGATGGGC-3' 2. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-ATGGCTCCATACATG-3'. 3. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-AUGGCUCCAUACAUG-3'. 4. The template strand is the strand of DNA used for RNA synthesis. 5. Transcription forms a messenger RNA molecule with a sequence that is identical to the DNA template from which it is prepared.