4.) what is the amino acid chain that your answer in item 2 will dictate? Question in Item 2: The complementary strand from item 1 undergoes transcription. What will be its mRNA complementary strand? Answer : The mRNA complementary strand from this complementary strand obtained from item 1 should be:AAGUUUCGCCCCGGG. 5.) Suppose that the amino acid chain in item 4 is altered. In what stage replication, transcription, or translation) could an error have occured? Explain your answer using the template DNA from item 1. Question in item 1 : if a DNA template with the sequence AAGTTTCGCCCCGGG undergoes replication, what will be its complementary DNA strand? Answer : According to complementary base pairing rules, A is complementary to T and G is complementary to C. Hence the complementary DNA strand should be:TTCAAAGCGGGGCCC

Q: put in correct order the steps for initiating translation. 1. Binding of initiator tRNA to mRNA 2.…

A: The translation is the process by which cells make proteins. Here, the mRNA formed by transcription…

Q: Consider the following DNA sequence: CATGTGTAGTCTAAA. Address the followin questions: AWrite the…

A: In DNA,the genes are present.From these genes mRNA is formed by transcription. This mRNA undergoes…

Q: Date: Class: Name: Transcription Questions Answer the following questions. 1. What bases are found…

A: DNA is the genetic materials of all most all eukaryotes and prokaryotes. RNA is genetic materials of…

Q: he Flynn effect is well known phenomenon in psychology. It states that, when using the same IQ test,…

A: The Flynn Effect is the tendency of IQ scores to change over time.

Q: a. Indicate whether point C is a 5' end or a 3' end of a nucleic acid. b. Indicate which strand…

A: The ribonucleic acid was the primary genetic material. It acts as a genetic material furthermore as…

Q: Match the following molecules to the correct description. DNA [ Choose ] [Choose ] exons, introns…

A: DNA- deoxyribonucleotides tRNA- anticodon and amino acids rRNA- ribosomes and protein translation…

Q: Question 1: Define and give an example of the following: Codon, Start Codon, Anticodon, and Stop…

A: In molecular biology,  translation is the process by which the data stored in mRNA is converted into…

Q: Choose the answer that has these events of the elongation phase of translation in the proper…

A: Translation refers to the production of proteins using mRNA and ribosomal machinery. The ribosome…

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: describe the process of reading a gene and turning it into a protein in a eukaryote.Your first…

A: Transcription: The process of conversion of segment of the DNA to RNA is called as Transcription.…

Q: The following sequence represents a few codons present in one strand of DNA.Using this strand of DNA…

A: DNA replication is the process of formation of copies of DNA. It takes place in nucleus of cell.…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: The following double stranded segment of DNA is part of a protein coding gene. The segments in…

A:

Q: Below is the template DNA sequence for an entire (short) gene that contains no introns. TRANSCRIBE…

A: The Central Dogma of Biology  DNA --(Transcription)-- RNA --(Translation) -- Protein  It says that…

Q: Use this diagram of a eukaryotic gene to answer the following questions. Pay close attention to the…

A: Introduction Gene expression is the process through which a gene's information is used to create a…

Q: How are introns recognized by snRNPs? Question 17 options: CTD of RNA polymerase II binds to…

A: The biochemical substance that is carried forward from the preceding generation to the succeeding…

Q: The diagram shows prokaryotic transcription. The DNA is shown in red and blue, the RNA is shown in…

A: The 3' end of the RNA strand is indicated by letter F.The 3' end of the lower DNA strand is…

Q: a)  One DNA strand of Chromosome #12 has the following nucleotide sequence: TAC/CGC/CCT. What…

A: DNA is a double stranded helical structure present inside the nucleus. It acts as a hereditary…

Q: Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA…

A: The core dogma notes that the sequence of learning most commonly found in our cells is: From…

Q: Consider which of the five mutations is most likely to cause Duchenne muscular dystrophy in this…

A: Duchenne muscular dystrophy is a disease charecterised by muscular weakness due to lack of a protein…

Q: Be sure to answer all parts. Consider the following mRNA sequence: 5'-GCU AGG CGA-3'. a. What amino…

A: Translation is the process in which the m rna is converted into a polypeptide chain of amino acids…

Q: The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1)…

A: At first you have to know about coding and non-coding strand. A coding atrand is a DNA strand that…

Q: onsider the following segment of DNA, which is part of a linear chromosome: LEFT…

A: Answer.  Transcription is a process of the formation of transcript (RNA). It takes place by the…

Q: The following eukaryotic DNA sequence is a made up gene. It is a mutated variant from the one that…

A: The genetic framework is a collection of instructions used by living cells to decipher data encoded…

Q: Explain the effect(s) the following scenarios would have on DNA replication or translation. For each…

A: Replication describes how cells continue to divide after they have completed the process of cell…

Q: A segment of DNA is shown below. This segment is located in the region of a gene near where…

A: Formation of a hair loop structure at the end of the termination site results in the termination of…

Q: The genetic code is redundant (i.e., most amino acids are coded for by more than one codon). Why is…

A: Redundancy refers to differences in the third base of the codons coding for the same amino acid.

Q: Give 7 examples where a specific nucleotide sequences/elements are recognized by protein or…

A: Replication is the process by which new strands of DNA are synthesized from pre-existing DNA.…

Q: Describe each stage of an action potential in terms of what ion channels are active. Edit View…

A: When a neuron is stimulated an action potential is generated by a change in ion concentrations…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: 2a) In prokaryotes, a small ribosomal subunit can potentially get on an mRNA anywhere it can find…

A: The translation is the process of polymerization of amino acids to form polypeptides or protein. It…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.