35. Transcription in eukaryotes requires which of the following in addition to RNA polymerase? A. The protein product of the promoter B. Start and stop codons C. Ribosomes and tRNA on D. Several transcription factors E. Aminoacyl synthetase ll yfout 25of the base

Q: Where is the start codon located?

A: A sequence of three nucleotides on the mRNA strand is known as the codon. Each codon codes for the…

Q: What happens when EF-Tu is mutated A. Be involved in transcription instead of translation B.…

A:

Q: 1. For each of the following, explain how eukaryotic transcriptional initiation would be affected.…

A: According to bartleby expert guidelines, when multiple questions are posted we are allowed to answer…

Q: a. The promoter is to the right so transcription goes right to left. b. This sequence 5’…

A: Transcription is is a cellular process by which DNA can produce RNA by the use of RNA polymerase…

Q: Formation of the 70S ribosomal initiation complex for prokaryotic translation requires A. Mn2+ B.…

A: The production of proteins made up of amino acids is a step in the translation process in cells.…

Q: . How many codons are there above in question 8? Label one of them in green.

A: Hello. Since you have posted multiple questions and not specified which question needs to be solved,…

Q: or s The diagram above illustrates the process of statement) Row А. B. C. D. i translation…

A: Translation is the process by which RNA is used to make proteins.Transcription is the process of…

Q: functional insulin required the association of two polypeptides known as the A and B chains…

A: Pre transcription control involves in DNA methylation.  Transcriptional control involves in…

Q: Mutation of which of these sequences would have an effect on translational initiation?   A. 3’ UTR…

A: Introduction  Prokaryotic transcription is the process by which prokaryotic genetic material is…

Q: A mutation in the Duchenne muscular dystrophy gene involves the deletion of two bases and their…

A: Boys are mostly affected by the Duchenne muscular dystrophy (DMD). It's an X-linked recessive…

Q: 83) The RDRP of the rotavirus a. Only produced in the first round of translation b. It is…

A: RdRP- is RNA dependent RNA polymerase. All retroviruses have RNA dependent RNA polymerases.

Q: Give one example of a prokaryotic system of gene expression that is more complicated (during…

A: Gene expression refers to the process by which the information stored in a gene is used to…

Q: 1. Write a short note on transcription. What is TFBS? What is the role of RNA polymerase?

A: Since you have asked multiple questions with multiple subparts, we will solve the first question for…

Q: .What type of mutation is seen here? WT:                       5′-AUG GCU AGA GUU GAA  AAA-3′…

A: Note - Since you have asked multiple questions, we will solve the first question for you. If you…

Q: mRNA maturation in eukaryotes includes all of the following EXCEPT: A. Topoisomerase activity B.…

A: In eukaryotic cells, the primary transcript undergoes post transcriptional modification to form a…

Q: . rat liver mannan-binding protein gene yields two different mRNA sizes 1.4 and 3.5 kb identify…

A: Pre transcriotion contol involved in DNA methylation and chromatin packing . Transcription control…

Q: a. b. What constitutes the protein-coding region of a mature mRNA molecule?

A: INTRODUCTION  The process of copying a segment of DNA into mRNA known as transcription. In the DNA…

Q: 35. rat liver manan-binding protein gene yields two different mRNA sizes - 1.4 and 3.5kb identify…

A: Mannan-binding protein (MBP), a mannose-binding lectin (MBL) protein, is a protein involved in the…

Q: I. List the sequences of RNA that would be transcribed from the following DNA template sequences. а.…

A: Transcription is the initial stage in gene expression, when genetic information is utilised to build…

Q: 1.This is where the RNA polymerase is bound and a short region of DNA is accessible to begin the…

A: This is where the RNA polymerase is bound and a short region of DNA is accessible to begin the…

Q: 55 __________________ assemble to form a spliceosome, the splicing machine that excises introns. A.…

A: Introduction Transcription is a process where mRNA is produced from DNA. After transcription mRNA…

Q: A nonsense mutation Select one: a. results in a larger protein being produced from the mutated gene…

A: Introduction :- There are a number of disorders known to be caused by nonsense mutations, including:…

Q: Select the events from eukaryotic transcription from the list below and list them below in order, by…

A: What is transcription? Transcription is the process where RNA is synthesized from DNA by the…

Q: 15. What percent of a typical mammalian genome is classified as an exon? A. 0.7% B. 1.5% C. 3.2% D.…

A: The complete set of genes or the total amount of genetic material present in a cell or an organism…

Q: which of the following is not a major factor in regulating specific protein content in the cell? A.…

A: Introduction  Cell regulation refers to the mechanisms and processes that control the behavior of…

Q: Which of the following activities DOES NOT happen during the initiation stage of transcription? A.…

A: Introduction :- The poly-A tail is a stretch of adenine nucleotides that is added to the 3' end of a…

Q: 46 What is the A-site of the ribosome? A. exit site b. aminoacyl-tRNA binding site c. peptidyl-tRNA…

A: Ribosomes are the protein factories of the cell. These are responsible for protein synthesis by…

Q: Which structure is responsible for translating MRNA? O a. RNA Polymerase II O b. RNA polymerase I O…

A: Introduction Messenger ribonucleic acid (mRNA) is a single-stranded RNA molecule that corresponds to…

Q: Which of the following RNA has a catalytic activity like an enzyme? A. mRNA C. rRNA B. tRNA D.…

A: RNA is ribonucleic acid which consists of ribose sugar, nitrogen base and a phosphate group.This is…

Q: Part of a gene is written below, and transcription begins at the boxed T/A base pair and proceeds…

A: Gene is present on a chromosome and contains hereditary information. These genes are later…

Q: in the human beta-globin, two introns are spliced out in order to produce the mature mRN

A: The gene regulation can be exercised at different levels where DNA can be packed tightly or loosely…

Q: Match these transcription-associated terms with the appropriate definition or function. DNA sequence…

A: The transcription of DNA occurs in 3 major steps, initiation, elongation and termination. The…

Q: 53. The DNA sequence from which a functional non-coding RNA is transcribed is often called an RNA…

A: The fundamental structural and operational unit of heredity is the gene. DNA nucleotides make up the…

Q: Once transcribed, eukaryotic mRNA typically undergoes substantial processing that includes Mark all…

A: The processing of eukaryotic mRNA is an important step in gene expression. Eukaryotic pre-mRNA has…

Q: tight packing of previously less condensed chromatin   identify which describes the statement…

A: Post translational modifications in histone proteins can change the shape of chromatin, which can…

Q: 1. Using the diagram below: a. Label the process identified by each arrow. b. Label the diagrams…

A: DNA stands for 'deoxyribonucleic acid'. It is the hereditary material in humans as well as in most…

Q: 26. Synthesis of a repressible enzyme is stopped by a the allosteric transition b. the substrate…

A: In the regulation of gene expression, various mechanisms come into play to control the activity of…

Q: Transcription in prokaryotes produces mRNA that is ready to translate, while in eukaryotes the RNA…

A: Transcription is a proces of synthesis of RNA from DNA.During transcription;only one of the strand…

Q: Translate the following mRNA transcript   5’CGCCGAUGCGCGAUAUGUGGUAA’3   A. RRCAICG   B. ADARYVV   C.…

A: mRNA, or messenger RNA is a type of RNA (ribonucleic acid) that plays a crucial role in the process…

Q: Which of the following statements is/are TRUE for transcription? A. RNA polymerase uses one strand…

A: Transcription is the process in which RNA is synthesized from DNA. This process involves certain…

Q: Formation of the 70S ribosomal initiation complex for prokaryotic translation requires: a.tRNAfMet…

A: Translation is the process of synthesis of protein. In prokaryotes, it occurs in cytosol, large and…

Q: . By use of a labeled diagram or a written description, distinguish the roles of the following in…

A: Translation is the process by which proteins are produced from mRNA templates.  All cells use the…

Q: I. RNA polymerase binds to the promoter and the DNA unwinds. II. RNA polymerase moves along the DNA…

A: The process of transcription involves copying (transcription) the DNA sequence of a gene to create…

Q: 36. What are the three major types of regulatory RNAs and what is their overall function? A.…

A: RNA- is a ribonucic acid.  A genome has thousands of genes. Out of which lot of them have not…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.