83) The RDRP of the rotavirus a. Only produced in the first round of translation b. It is responsible to for the production of both the negative and positive sense strands of the dsRNA genome. c. Is working on the positive strand of the genomic RNA to produce the mRNA d. Is produced only in the second round of translation.

Q: Although the specific mechanism of RNA interference has not been fully defined, it involves A. the…

A: The RNA interference works at the post transcriptional level because it occurs after the synthesis…

Q: A particular mature miRNA (microRNA) in mice has sequence 5'-UUCCCUGAGACCUCAAGUGUGA-3'. a. If you…

A: Answer a) ii and iii ii) mRNA sequence complementary to the miRNA sequence iii) miRNA sequence with…

Q: Bacterial RNA that can act both as an mRNA and a tRNA Group of answer choices a.Micro RNA b.Guide…

A: The gene that a eukaryotic cell turns "on" to a great extent decide its personality and properties.…

Q: If we watched a eukaryotic cell initiate translation, one of the first things we would see is   a.…

A: Transcription is the process by which the information in the gene is coded into a mRNA (messenger…

Q: 38) Termination     begins when there is an AUG at the A site     begins with a termination codon…

A: Termination is the final step in the translation process. When a stop codon (UAA, UAG, or UGA) in…

Q: For a riboswitch that controls transcription, the binding of a small molecule such as TPP controls…

A: Bacteria are genetically regulated by RNA, they use a ribonucleic acid sequence encoded within mRNA…

Q: Identify the correct recognition site for ribosome subunit binding during transcription. A. the 40s…

A: Transcription is the synthesis of mRNA from a DNA template which occurs in 5'-3' direction.During…

Q: If the following RNA polymerases were missing from a eukaryotic cell, what types of genes would not…

A: Eukaryotes contains multiple RNA polymerases that transcribes distinct classes of genes. They do not…

Q: The following protein sequence was made. N-MET TYR GLN GLN CYS-C a. Using the top most option from…

A: Introduction Amino acids are chemical molecules that combine to produce proteins; hence, they are…

Q: B Elongation

A: The translation is the process by which the genetic information contained in mRNA (messenger RNA) is…

Q: mRNA maturation in eukaryotes includes all of the following EXCEPT: A. Topoisomerase activity B.…

A: In eukaryotic cells, the primary transcript undergoes post transcriptional modification to form a…

Q: a. CRISPR-Cas9 is a valuable biotechnology tool. Explain how this system uses RNA and the result of…

A: CRISPR-Cas9  is known as unique biotechnology tool which allows medical researchers and geneticists…

Q: particular triplet of bases in the template strand of DNA is SAGT- What would be the corresponding…

A:

Q: Eukaryotic RNA polymerase II resembles the prokaryotic RNA polymerase core. Which of the following…

A: Prokaryotes have only one RNA polymerase called prokaryotic RNA polymerase, but eukaryotes have…

Q: RNA processing events include A. self splicing B. methylation of 45S FRNA C. snoRNA facilitates…

A: Introduction: RNA processing involves newly transcribed RNA molecules (primary transcript)…

Q: Eukaryotes can control transcription by three overall type of process, they are ( selection from…

A: The regulation of transcription is more complex in eukaryotes as compared to prokaryotes. This…

Q: Which part of a tRNA molecule acts as an amino acid attachment site?   a. the 5' end   b.…

A: tRNA (transfer ribonucleic acid) molecule escorts amino acids to their correct location in a…

Q: Translation can be regulated by a. translational repressors. b. antisense RNA. c. attenuation. d.…

A: The translation is the term for the synthesis of a polypeptide chain from the decoding of…

Q: Sequential binding of RNA polymerase II-TFIIF complex, TFIIE, and TFIIH completes…

A: RNA Polymerase II is responsible for the transcription of messenger RNA with the help of DNA. For…

Q: 26. Synthesis of a repressible enzyme is stopped by a the allosteric transition b. the substrate…

A: In the regulation of gene expression, various mechanisms come into play to control the activity of…

Q: Translate the following mRNA transcript   5’CGCCGAUGCGCGAUAUGUGGUAA’3   A. RRCAICG   B. ADARYVV   C.…

A: mRNA, or messenger RNA is a type of RNA (ribonucleic acid) that plays a crucial role in the process…

Q: When an ncRNA functions as a decoy, ita. contains binding sites for many different proteins,…

A: Non-coding RNA (ncRNA) refer to the RNA molecules that are not translated into proteins. The…

Q: microRNAs (miRNAs) play important roles in gene regulation. What is the correct order of steps…

A: A class of short, endogenous RNAs with a length of 21–25 nucleotides (nts) is known as microRNAs…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.