.What type of mutation is seen here? WT:                       5′-AUG GCU AGA GUU GAA  AAA-3′ Mutant:              5′-AUG GGU AGA GUU GAA  AAA-3′ Group of answer choices a. Transition b. Tranversion c. Insertion d. Deletion

Q: Retrotransposons are mediated by the enzyme O a. transposase O b. RISC O c retrotransposase O d.…

A: Retrotransposons move by a copy and paste mechanism. However transportions describe the copy is made…

Q: What is the default state of the lac operon? a. LacI repressor is sitting on the operator sequence…

A: Lacl repressor is sitting on a operator sequence and blocks RNAP from transcribing lacZYA

Q: 1. For each of the following, explain how eukaryotic transcriptional initiation would be affected.…

A: According to bartleby expert guidelines, when multiple questions are posted we are allowed to answer…

Q: The RNA-induced silencing complex (RISC) _____ i. Binds to and unwinds ds siRNA/miRNA to produce…

A: The answet is b. II only RNA-induced silencing complex(RISC) is a multiprotein complex which…

Q: he bands indicated by arrow "A" (to the left of the western blot) most likely represent:   A.…

A: The bands indicated by arrow "A" (to the left of the western blot) most likely represent:-

Q: Geneticists isolated six trains of E. coli (strains 1-6) whose lac operons had one of the following…

A: LAC operon of E. coli is an example of inducible gene expression system. Lactose acts as inducer…

Q: 6. By incubating cells with an inhibitor of TFIIH helicase activity. Which step in the transcript…

A: Answer - The initiation & the starting of the elongation process will be stopped if the cell is…

Q: 1.True or false: In a bacterial species with a "lac operon", the repressor protein will be bound to…

A: Prokaryotic gene regulatory system is known as operon system. In this process the expression of…

Q: 1. In E.coli transcription of the Lac Operon is known to be under Global control. For this operon…

A: The lac operon, found in E. coli, comprises genes responsible for lactose transport and metabolism1.…

Q: 12. You want to determine the location of the promoter and operator for an operon. To do so, you…

A: 1) If operator is removed, expression becomes constitutive 2) If promoter is removed, there should…

Q: graduate student wants to isolate cells from a patient and grow them perpetually in culture to study…

A: The correct answers are as follows- A. Telomerase C. MDM2  A graduate student wants to isolate cells…

Q: Match the terms with the type of transposon B. IS A. retrotranspson abundant in humans A L1 8 DNA…

A: A DNA (deoxyribonucleic acid)  that is capable of transposition, such segments are mostly found in…

Q: A. Somatic cells are aslo called B. In irder to clone a gene,

A: A Somatic cells are also called Body cells .  Any other cells other than gametes are called somatic…

Q: 3). Consider the four mutations (i-iv) described below: i. One of the mutations causing cystic…

A: A mutation is a permanent change in the DNA sequence of an organism's genome. Mutations can occur…

Q: Geneticists isolated six trains of E. coli (strains 1-6) whose lac operons had one of the following…

A: Lac operon It is an operon that is needed for the movement and metabolism of lactose in E. coli.

Q: 1. Lac and Trp Operon are two different processes of sugar and amino acid. Describe the differences…

A: Lac and Trp operon are found in E. coli and other bacteria.

Q: 83) The RDRP of the rotavirus a. Only produced in the first round of translation b. It is…

A: RdRP- is RNA dependent RNA polymerase. All retroviruses have RNA dependent RNA polymerases.

Q: 10. Modify the diagrams below to reflect the activation and repression of lac operon. Use arrows,…

A: Lac operon contains genes involved in metabolism. The genes are expressed only when lactose is…

Q: I. CAP-CAMP complex binds to the operator locus blocking the RNA polymerase. II. In the presence of…

A: The lactose operon (also known as the lac operon) is a set of genes that are specific for uptake and…

Q: The transcription initiation factor “recruited” together with RNA-Pol II in the formation of…

A: Transcription is a process of making an RNA copy from a gene’s DNA sequence. This is known as…

Q: QUESTION 3 DNA methylation O a. You cannot methylate DNA O b. Enhances O c. Represses O d. Represses…

A:

Q: The reason LacZ is frequently used as a reporter gene is: a. The lacZ gene product binds to the…

A: LacZ is a gene of lac operon which codes for β-galactosidase. The reporter genes cause a visible…

Q: RNA processing events include A. self splicing B. methylation of 45S FRNA C. snoRNA facilitates…

A: Introduction: RNA processing involves newly transcribed RNA molecules (primary transcript)…

Q: I am a Physician Scientist and have a patient that presents with colorectal cancer. I decide to…

A: Given the scenario you've described, where a novel SNP leads to a premature stop codon in a gene…

Q: 1. What are the main elements of the lac operon and their functions?

A: NOTE- Since you have posted multiple questions So we will be solving the first question for you. As…

Q: Under the following conditions, what will be occurring with the lac operon? Glucose: Present…

A: lac operon is present in E.coli and contain genes that control lactose metabolism and only active…

Q: 17. NF1 protein ---- Ras signaling. a. activates b. inhibits 18. The deacetylation of the histones…

A: *NOTE: Kindly repost for other questions. Dear Student as per the guidelines we are supposed to…

Q: The nr2f5 gene is transcribed into mRNA in both neurons and glia. The microRNA miR-5xb has partial…

A: Introduction  The expression of genes is highly regulated in both prokaryotes as well as in…

Q: 5. As you know, the lac promoter is a poor intrinsic promoter: it is transcribed efficiently only…

A: Q 5.) Ans.The given question explores the lac operon's regulation in E. coli through mutagenesis and…

Q: An EMS mutagenesis screen identified several mutants in this gene. The figure shows the position of…

A: "As per the Q&A guidelines, we will provide the solution to the first question. Please repost…

Q: Which of the following regions of the DNA is transcribed by RNA polymerase AND is “understood” by…

A: Transcription  Transcription is the process where DNA is transcribed into RNA with the help of…

Q: I. Answer the following: 1. What are the main elements of the lac operon and their functions? 2.…

A: Definition:- An operon is a group of genes that are transcribed at the same time.  These are a…

Q: You are studying lung cancer and use a microarray to compare gene expression between a lung cancer…

A: Note:- Since you have posted multiple questions, so we will be solving the first one for you as per…

Q: Which of the following conditions will result to deactivation of a gene? a. histone methylation b.…

A: In this question we have to describe about regulation of genes . See full answer in step 2.

Q: The excision of benign or malignant lesions cannot be reported in addition to which of the following…

A: Repair and closure (12001 - 13160)

Q: Genes in a bacteriophage that are expressed after expression of genes that initiate the lytic cycle…

A: There are three classes of genes in the phage genome that regulate whether the lytic or lysogenic…

Q: Translate the following mRNA transcript   5’CGCCGAUGCGCGAUAUGUGGUAA’3   A. RRCAICG   B. ADARYVV   C.…

A: mRNA, or messenger RNA is a type of RNA (ribonucleic acid) that plays a crucial role in the process…

Q: a. A short segment of microRNA that becomes incorporated into DNA b. A segment of DNA that contains…

A: A gene is the basic physical and functional unit of heredity. Genes are made up of DNA.

Q: Based on Pruisner (2013), match each of the following terms with its appropriate definition or…

A: Genes are sequences of DNA present in the chromosome of an organism that code for certain…

Q: What type of genetic alteration allows p53 to promote cell growth

A: The missense point mutation on exon 7 of p53 gene promote the cell growth which later leads to the…

Q: Provide the SIGNIFICANT differences between the following: 1. Operon Systems Inducer/Lac…

A: An operon is a cluster of functional genes which are regulated by the common operator. Operons…

Q: You would like to study the effect of GeneX in the developing mouse liver. However, your supervisor…

A: Embryonic lethality is a type of phenotype that occurs in mice that are homozygous in nature for…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.